Morpholino
MO2-klf8
- ID
- ZDB-MRPHLNO-150928-4
- Name
- MO2-klf8
- Previous Names
-
- klf8-MO2 ATG (1)
- Target
- Sequence
-
5' - TTTTGTTCCGAGTCTCCGTGTGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-klf8
Expressed Gene | Anatomy | Figures |
---|---|---|
gata6 |
Fig. 1 ![]() |
|
lft1 |
|
Fig. 2 ![]() |
lft2 |
|
Fig. 2 ![]() |
myl7 |
Fig. 1 ![]() |
|
pitx2 |
Fig. 2 ![]() |
1 - 5 of 7 Show all
Phenotype
Phenotype resulting from MO2-klf8
1 - 5 of 33 Show all
Phenotype of all Fish created by or utilizing MO2-klf8
1 - 5 of 33 Show all
Citations
- Lin, C.Y., Tsai, M.Y., Liu, Y.H., Lu, Y.F., Chen, Y.C., Lai, Y.R., Liao, H.C., Lien, H.W., Yang, C.H., Huang, C.J., Hwang, S.L. (2017) Klf8 regulates left-right asymmetric patterning through modulation of Kupffer's vesicle morphogenesis and spaw expression. Journal of Biomedical Science. 24:45
- Tsai, M., Lu, Y., Liu, Y., Lien, H., Huang, C., Wu, J., Hwang, S.L. (2015) Modulation of p53 and met expression by krüppel-like factor 8 regulates zebrafish cerebellar development. Developmental Neurobiology. 75(9):908-26
1 - 2 of 2
Show