Morpholino
MO2-wnt5b
- ID
- ZDB-MRPHLNO-051207-1
- Name
- MO2-wnt5b
- Previous Names
- None
- Target
- Sequence
-
5' - TGTTTATTTCCTCACCATTCTTCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 3' end of the exon-intron junction of exon 3. Robu et al. report that it is the splice-site–exon 6 splice acceptor (exon 5–6 junction)that is targeted.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt5b
Expressed Gene | Anatomy | Figures |
---|---|---|
cdkn1a |
Fig. 8 ![]() |
|
cp |
Fig. 6 ![]() |
|
cpa5 |
Fig. 6 ![]() |
|
foxa3 |
Fig. 4 ![]() |
|
gata6 |
Fig. 4 ![]() |
1 - 5 of 15 Show all
Phenotype
Phenotype resulting from MO2-wnt5b
1 - 5 of 17 Show all
Phenotype of all Fish created by or utilizing MO2-wnt5b
1 - 5 of 21 Show all
Citations
- Gutzman, J.H., Graeden, E., Brachmann, I., Yamazoe, S., Chen, J.K., Sive, H. (2018) Basal constriction during midbrain-hindbrain boundary morphogenesis is mediated by Wnt5b and focal adhesion kinase. Biology Open. 7(11):
- Merks, A.M., Swinarski, M., Meyer, A.M., Müller, N.V., Özcan, I., Donat, S., Burger, A., Gilbert, S., Mosimann, C., Abdelilah-Seyfried, S., Panáková, D. (2018) Planar cell polarity signalling coordinates heart tube remodelling through tissue-scale polarisation of actomyosin activity. Nature communications. 9:2161
- Visetsouk, M.R., Falat, E.J., Garde, R.J., Wendlick, J.L., Gutzman, J.H. (2018) Basal epithelial tissue folding is mediated by differential regulation of microtubules. Development (Cambridge, England). 145(22):
- De Rienzo, G., Gutzman, J.H., and Sive, H. (2012) Efficient shRNA-Mediated Inhibition of Gene Expression in Zebrafish. Zebrafish. 9(3):97-107
- Robu, M.E., Larson, J.D., Nasevicius, A., Beiraghi, S., Brenner, C., Farber, S.A., and Ekker, S.C. (2007) p53 activation by knockdown technologies. PLoS Genetics. 3(5):e78
- Kim, H.J., Schleiffarth, J.R., Jessurun, J., Sumanas, S., Petryk, A., Lin, S., and Ekker, S.C. (2005) Wnt5 signaling in vertebrate pancreas development. BMC Biology. 3:23
1 - 6 of 6
Show