Morpholino

MO1-apela

ID
ZDB-MRPHLNO-191209-4
Name
MO1-apela
Previous Names
None
Target
Sequence
5' - TGGAAGAATCTCATGGTGATGCTCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-apela
Expressed Gene Anatomy Figures
dnah9 Fig. 7 with image from Zhu et al., 2019
etv5b Fig. 7 with image from Zhu et al., 2019
fgf8a Fig. 7 with image from Zhu et al., 2019
foxj1a Fig. 7 with image from Zhu et al., 2019
lft1 Fig. 8 with image from Zhu et al., 2019
lft2 Fig. 6 with image from Zhu et al., 2019
otx5 Fig. 5\ with image from Zhu et al., 2019
shha Fig. 8 with image from Zhu et al., 2019
sox17 Fig. 4 with image from Zhu et al., 2019
spaw Fig. 6 with image from Zhu et al., 2019
Phenotype
Phenotype resulting from MO1-apela
Phenotype Fish Figures
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO1-apela Fig. 6 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apela Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-apela Fig. 5\ with image from Zhu et al., 2019
forerunner cell group foxj1a expression decreased amount, abnormal AB + MO1-apela Fig. 7 with image from Zhu et al., 2019
forerunner cell group sox17 expression decreased distribution, abnormal AB + MO1-apela Fig. 4 with image from Zhu et al., 2019
heart cell decreased amount, abnormal twu34Tg + MO1-apela Fig. S9 with image from Zhu et al., 2019
heart primordium lft2 expression absent, abnormal AB + MO1-apela Fig. 6 with image from Zhu et al., 2019
heart primordium right side lft2 expression mislocalised, abnormal AB + MO1-apela Fig. 6 with image from Zhu et al., 2019
Kupffer's vesicle absent, abnormal AB + MO1-apela Fig. 3,  Fig. 6 with image from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-apela Fig. 3,  Fig. 6 with image from Zhu et al., 2019
Kupffer's vesicle etv5b expression increased amount, abnormal AB + MO1-apela Fig. 7 with image from Zhu et al., 2019
lateral plate mesoderm spaw expression absent, abnormal AB + MO1-apela Fig. 6 with image from Zhu et al., 2019
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-apela Fig. 6 with image from Zhu et al., 2019
telencephalon determination of left/right asymmetry in nervous system decreased process quality, abnormal AB + MO1-apela Fig. 5\ with image from Zhu et al., 2019
telencephalon lateral side otx5 expression mislocalised, abnormal AB + MO1-apela Fig. 5\ with image from Zhu et al., 2019
trunk medial region lft1 expression decreased amount, abnormal AB + MO1-apela Fig. 8 with image from Zhu et al., 2019
whole organism foxj1a expression decreased amount, abnormal AB + MO1-apela Fig. 7 with image from Zhu et al., 2019
whole organism morphology, abnormal AB + MO1-apela Fig. S9 with image from Zhu et al., 2019
Phenotype of all Fish created by or utilizing MO1-apela
Phenotype Fish Conditions Figures
whole organism morphology, abnormal AB + MO1-apela standard conditions Fig. S9 with image from Zhu et al., 2019
lateral plate mesoderm spaw expression absent, abnormal AB + MO1-apela standard conditions Fig. 6 with image from Zhu et al., 2019
heart primordium lft2 expression absent, abnormal AB + MO1-apela standard conditions Fig. 6 with image from Zhu et al., 2019
forerunner cell group sox17 expression decreased distribution, abnormal AB + MO1-apela standard conditions Fig. 4 with image from Zhu et al., 2019
heart primordium right side lft2 expression mislocalised, abnormal AB + MO1-apela standard conditions Fig. 6 with image from Zhu et al., 2019
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-apela standard conditions Fig. 6 with image from Zhu et al., 2019
whole organism foxj1a expression decreased amount, abnormal AB + MO1-apela standard conditions Fig. 7 with image from Zhu et al., 2019
telencephalon lateral side otx5 expression mislocalised, abnormal AB + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
Kupffer's vesicle etv5b expression increased amount, abnormal AB + MO1-apela standard conditions Fig. 7 with image from Zhu et al., 2019
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO1-apela standard conditions Fig. 6 with image from Zhu et al., 2019
telencephalon determination of left/right asymmetry in nervous system decreased process quality, abnormal AB + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
trunk medial region lft1 expression decreased amount, abnormal AB + MO1-apela standard conditions Fig. 8 with image from Zhu et al., 2019
forerunner cell group foxj1a expression decreased amount, abnormal AB + MO1-apela standard conditions Fig. 7 with image from Zhu et al., 2019
Kupffer's vesicle absent, abnormal AB + MO1-apela standard conditions Fig. 3,  Fig. 6 with image from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-apela standard conditions Fig. 3,  Fig. 6 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal as3Tg + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal as3Tg + MO1-apela standard conditions Fig. 5\ with image from Zhu et al., 2019
heart cell decreased amount, abnormal twu34Tg + MO1-apela standard conditions Fig. S9 with image from Zhu et al., 2019
whole organism morphology, abnormal twu34Tg + MO1-apela standard conditions Fig. S9 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apela + MO1-aplnra standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-apela + MO1-aplnra standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apela + MO1-aplnrb standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-apela + MO1-aplnrb standard conditions Fig. 5\ with image from Zhu et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.