Morpholino

MO1-fscn1a

ID

ZDB-MRPHLNO-160929-1

Name

MO1-fscn1a

Previous Names

None

Target

fscn1a (1)

Sequence

5' - TGTCGCTGGTTCCGTTTGCAGTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fscn1a

Expressed Gene	Anatomy	Figures
bbc3	whole organism	Fig. S3 from Boer et al., 2016
dlx2a	pharyngeal arch migratory cranial neural crest cell pharynx neural crest cell	Fig. 3 from Boer et al., 2016 Fig. S2 from Liu et al., 2016
foxa1	gut (not) liver primordium posterior pancreatic bud	Fig. 2 , Fig. S6 from Liu et al., 2016
foxd3	neural crest neural plate border premigratory cranial neural crest	Fig. 3 from Boer et al., 2016 Fig. S2 from Liu et al., 2016
gsc	mesoderm	Fig. S3 from Liu et al., 2016
hhex	liver (not) liver primordium (not) posterior pancreatic bud	Fig. 2 , Fig. S6 from Liu et al., 2016
nkx2.3	pharyngeal pouch	Fig. 2 from Liu et al., 2016
sox10	cranial neural crest neural crest	Fig. 3 from Boer et al., 2016
sox17	endoderm endodermal cell forerunner cell group	Fig. 2 , Fig. 3 , Fig. 4 , Fig. S6 from Liu et al., 2016
sox32	endoderm endodermal cell forerunner cell group presumptive endoderm	Fig. 2 , Fig. 3 , Fig. 4 , Fig. 6 from Liu et al., 2016
tbxta	mesoderm	Fig. S3 from Liu et al., 2016
th	sympathetic neuron	Fig. 4 from Boer et al., 2016

Phenotype

Phenotype resulting from MO1-fscn1a

Phenotype	Fish	Figures
cranial neural crest cell cell death increased occurrence, abnormal	vu234Tg + MO1-fscn1a + MO4-tp53	Fig. 2 , Fig. 5 from Boer et al., 2016
cranial neural crest cell filopodium decreased amount, abnormal	vu234Tg + MO1-fscn1a + MO4-tp53	Fig. 2 from Boer et al., 2016
cranial neural crest cell filopodium decreased length, abnormal	vu234Tg + MO1-fscn1a + MO4-tp53	Fig. 2 from Boer et al., 2016
digestive tract development decreased occurrence, abnormal	TU + MO1-fscn1a	Fig. 2 from Liu et al., 2016
embryonic liver development decreased occurrence, abnormal	TU + MO1-fscn1a	Fig. 2 from Liu et al., 2016
endoderm sox17 expression decreased amount, abnormal	TU + MO1-fscn1a	Fig. 4 , Fig. S6 from Liu et al., 2016
endoderm sox32 expression decreased amount, abnormal	TU + MO1-fscn1a	Fig. 4 from Liu et al., 2016
endoderm development decreased occurrence, abnormal	TU + MO1-fscn1a	Fig. 2 from Liu et al., 2016
endodermal cell sox17 expression decreased amount, abnormal	TU + MO1-fscn1a	Fig. 2 , Fig. 3 from Liu et al., 2016
endodermal cell sox32 expression decreased amount, abnormal	TU + MO1-fscn1a	Fig. 2 , Fig. 3 from Liu et al., 2016
epiboly decreased rate, abnormal	TU + MO1-fscn1a	Fig. S3 from Liu et al., 2016
gut foxa1 expression decreased amount, abnormal	TU + MO1-fscn1a	Fig. 2 from Liu et al., 2016
head cell death increased occurrence, abnormal	vu234Tg + MO1-fscn1a + MO4-tp53	Fig. 5 from Boer et al., 2016
liver hhex expression decreased amount, abnormal	TU + MO1-fscn1a	Fig. 2 from Liu et al., 2016
liver primordium hhex expression absent, abnormal	TU + MO1-fscn1a	Fig. 2 , Fig. S6 from Liu et al., 2016
liver primordium foxa1 expression absent, abnormal	TU + MO1-fscn1a	Fig. 2 , Fig. S6 from Liu et al., 2016
neural crest cell migration decreased occurrence, abnormal	TU + MO1-fscn1a	Fig. S2 from Liu et al., 2016
nodal signaling pathway decreased occurrence, abnormal	TU + MO1-fscn1a	Fig. 3 , Fig. 4 from Liu et al., 2016
pancreas development decreased occurrence, abnormal	TU + MO1-fscn1a	Fig. 2 from Liu et al., 2016
peripheral nervous system development process quality, abnormal	w37Tg + MO1-fscn1a + MO4-tp53	Fig. 4 from Boer et al., 2016
pharyngeal arch decreased size, abnormal	ir937Tg + MO1-fscn1a + MO4-tp53	Fig. 4 from Boer et al., 2016
pharyngeal pouch nkx2.3 expression decreased amount, abnormal	TU + MO1-fscn1a	Fig. 2 from Liu et al., 2016
pharyngeal pouch neural crest cell migration decreased occurrence, abnormal	ir937Tg + MO1-fscn1a + MO4-tp53	Fig. 3 from Boer et al., 2016
pharyngeal pouch neural crest cell migration process quality, abnormal	ir937Tg + MO1-fscn1a + MO4-tp53	Fig. 3 from Boer et al., 2016
pharynx development decreased occurrence, abnormal	TU + MO1-fscn1a	Fig. 2 from Liu et al., 2016
posterior pancreatic bud hhex expression absent, abnormal	TU + MO1-fscn1a	Fig. 2 from Liu et al., 2016
posterior pancreatic bud foxa1 expression decreased amount, abnormal	TU + MO1-fscn1a	Fig. S6 from Liu et al., 2016
posterior pancreatic bud hhex expression decreased amount, abnormal	TU + MO1-fscn1a	Fig. 2 , Fig. S6 from Liu et al., 2016
presumptive endoderm sox32 expression decreased amount, abnormal	TU + MO1-fscn1a	Fig. 2 , Fig. 6 from Liu et al., 2016
ventral mandibular arch decreased size, abnormal	ir937Tg + MO1-fscn1a + MO4-tp53	Fig. 4 from Boer et al., 2016
whole organism ab3-smad2 labeling decreased amount, abnormal	TU + MO1-fscn1a	Fig. 3 from Liu et al., 2016

Phenotype of all Fish created by or utilizing MO1-fscn1a

Phenotype	Fish	Conditions	Figures
endoderm sox17 expression decreased amount, abnormal	fscn1a^{ioz100/ioz100} + MO1-fscn1a	standard conditions	Fig. S6 from Liu et al., 2016
endoderm development decreased occurrence, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 from Liu et al., 2016
liver primordium foxa1 expression absent, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 , Fig. S6 from Liu et al., 2016
pharynx development decreased occurrence, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 from Liu et al., 2016
gut foxa1 expression decreased amount, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 from Liu et al., 2016
pharyngeal pouch nkx2.3 expression decreased amount, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 from Liu et al., 2016
endodermal cell sox17 expression decreased amount, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 , Fig. 3 from Liu et al., 2016
posterior pancreatic bud hhex expression absent, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 from Liu et al., 2016
pancreas development decreased occurrence, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 from Liu et al., 2016
neural crest cell migration decreased occurrence, abnormal	TU + MO1-fscn1a	standard conditions	Fig. S2 from Liu et al., 2016
nodal signaling pathway decreased occurrence, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 3 , Fig. 4 from Liu et al., 2016
posterior pancreatic bud hhex expression decreased amount, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 , Fig. S6 from Liu et al., 2016
epiboly decreased rate, abnormal	TU + MO1-fscn1a	standard conditions	Fig. S3 from Liu et al., 2016
endoderm sox32 expression decreased amount, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 4 from Liu et al., 2016
presumptive endoderm sox32 expression decreased amount, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 , Fig. 6 from Liu et al., 2016
digestive tract development decreased occurrence, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 from Liu et al., 2016
whole organism ab3-smad2 labeling decreased amount, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 3 from Liu et al., 2016
liver primordium hhex expression absent, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 , Fig. S6 from Liu et al., 2016
endoderm sox17 expression decreased amount, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 4 , Fig. S6 from Liu et al., 2016
embryonic liver development decreased occurrence, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 from Liu et al., 2016
endodermal cell sox32 expression decreased amount, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 , Fig. 3 from Liu et al., 2016
posterior pancreatic bud foxa1 expression decreased amount, abnormal	TU + MO1-fscn1a	standard conditions	Fig. S6 from Liu et al., 2016
liver hhex expression decreased amount, abnormal	TU + MO1-fscn1a	standard conditions	Fig. 2 from Liu et al., 2016
pharyngeal pouch neural crest cell migration process quality, abnormal	ir937Tg + MO1-fscn1a + MO4-tp53	standard conditions	Fig. 3 from Boer et al., 2016
pharyngeal pouch neural crest cell migration decreased occurrence, abnormal	ir937Tg + MO1-fscn1a + MO4-tp53	standard conditions	Fig. 3 from Boer et al., 2016
pharyngeal arch decreased size, abnormal	ir937Tg + MO1-fscn1a + MO4-tp53	standard conditions	Fig. 4 from Boer et al., 2016
ventral mandibular arch decreased size, abnormal	ir937Tg + MO1-fscn1a + MO4-tp53	standard conditions	Fig. 4 from Boer et al., 2016
cranial neural crest cell cell death increased occurrence, abnormal	vu234Tg + MO1-fscn1a + MO4-tp53	standard conditions	Fig. 2 , Fig. 5 from Boer et al., 2016
head cell death increased occurrence, abnormal	vu234Tg + MO1-fscn1a + MO4-tp53	standard conditions	Fig. 5 from Boer et al., 2016
cranial neural crest cell filopodium decreased amount, abnormal	vu234Tg + MO1-fscn1a + MO4-tp53	standard conditions	Fig. 2 from Boer et al., 2016
cranial neural crest cell filopodium decreased length, abnormal	vu234Tg + MO1-fscn1a + MO4-tp53	standard conditions	Fig. 2 from Boer et al., 2016
peripheral nervous system development process quality, abnormal	w37Tg + MO1-fscn1a + MO4-tp53	standard conditions	Fig. 4 from Boer et al., 2016
whole organism Ab2-fscn1 labeling decreased amount, abnormal	tp53^zdf1/zdf1 + MO1-fscn1a	standard conditions	Fig. 1 from Boer et al., 2016
pharyngeal arch migratory cranial neural crest cell dlx2a expression decreased amount, abnormal	tp53^zdf1/zdf1 + MO1-fscn1a	standard conditions	Fig. 3 from Boer et al., 2016
sympathetic ganglion development process quality, abnormal	tp53^zdf1/zdf1 + MO1-fscn1a	standard conditions	Fig. 4 from Boer et al., 2016
cranial neural crest cell cell death increased occurrence, abnormal	tp53^zdf1/zdf1 + MO1-fscn1a	standard conditions	Fig. 5 from Boer et al., 2016
head cell death increased occurrence, abnormal	tp53^zdf1/zdf1 + MO1-fscn1a	standard conditions	Fig. 5 from Boer et al., 2016
whole organism bbc3 expression increased amount, abnormal	tp53^zdf1/zdf1 + MO1-fscn1a	standard conditions	Fig. S3 from Boer et al., 2016
peripheral nervous system development process quality, abnormal	tp53^zdf1/zdf1 + MO1-fscn1a	standard conditions	Fig. 4 from Boer et al., 2016
cranial skeletal system development process quality, abnormal	tp53^zdf1/zdf1 + MO1-fscn1a	standard conditions	Fig. 1 from Boer et al., 2016
heart edematous, abnormal	tp53^zdf1/zdf1 + MO1-fscn1a	standard conditions	Fig. 1 from Boer et al., 2016

Citations