Morpholino

MO3-rspo1

ID
ZDB-MRPHLNO-111104-5
Name
MO3-rspo1
Previous Names
  • exon 1 splice donor MO (1)
Target
Sequence
5' - AGAAACATCAGCACTCACTCCGTCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-rspo1
Expressed Gene Anatomy Figures
cdh5 Fig. S3 with image from Genthe et al., 2017
crestin Fig. S4 with image from Genthe et al., 2017
dlc Fig. 3 with image,  Fig. S3 with image,  Fig. S5 with image,  Fig. S6 with image from Genthe et al., 2017
dld Fig. 3 with image,  Fig. S5 with image,  Fig. S6 with image from Genthe et al., 2017
efnb2a Fig. S3 with image from Genthe et al., 2017
foxn1 Fig. S4 with image from Genthe et al., 2017
gata1a Fig. S4 with image from Genthe et al., 2017
myb Fig. 1 with image,  Fig. 5 with image from Genthe et al., 2017
myod1 Fig. S4 with image from Genthe et al., 2017
notch1a Fig. 3 with image from Genthe et al., 2017
notch1b Fig. 3 with image from Genthe et al., 2017
notch2 Fig. 3 with image from Genthe et al., 2017
notch3 Fig. 3 with image from Genthe et al., 2017
rag1 Fig. 1 with image,  Fig. 5 with image from Genthe et al., 2017
rspo1 Fig. S1 with image,  Fig. S2 with image from Genthe et al., 2017
runx1 Fig. 1 with image,  Fig. 5 with image,  Fig. S2 with image from Genthe et al., 2017
shha Fig. 4 with image from Genthe et al., 2017
tgfb1a Fig. 4 with image from Genthe et al., 2017
tgfb1b Fig. 4 with image from Genthe et al., 2017
tgfbr2b Fig. 4 with image from Genthe et al., 2017
vegfaa Fig. 4 with image,  Fig. S7 with image from Genthe et al., 2017
vegfc Fig. 6 with image from Gore et al., 2011
wnt16 Fig. 2 with image,  Fig. S2 with image from Genthe et al., 2017
Phenotype
Phenotype resulting from MO3-rspo1
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg/y1Tg + MO3-rspo1 Fig. 3 with image from Gore et al., 2011
anterior mesencephalic central artery absent, abnormal y1Tg/y1Tg + MO3-rspo1 Fig. 4 with image from Gore et al., 2011
cerebellar central artery absent, abnormal y1Tg/y1Tg + MO3-rspo1 Fig. 4 with image from Gore et al., 2011
dorsal aorta hematopoietic stem cell runx1 expression absent, abnormal WT + MO3-rspo1 Fig. S2 with image from Genthe et al., 2017
dorsal aorta hematopoietic stem cell myb expression absent, abnormal WT + MO3-rspo1 Fig. 1 with image from Genthe et al., 2017
dorsal aorta hematopoietic stem cell absent, abnormal WT + MO3-rspo1 Fig. 1 with image,  Fig. S2 with image from Genthe et al., 2017
dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO3-rspo1 Fig. 1 with image,  Fig. 5 with image from Genthe et al., 2017
intersegmental vessel decreased amount, abnormal y1Tg/y1Tg + MO3-rspo1 Fig. 4 with image from Gore et al., 2011
intersegmental vessel decreased length, abnormal y1Tg/y1Tg + MO3-rspo1 Fig. 3 with image from Gore et al., 2011
intersegmental vessel branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg/s843Tg + MO3-rspo1 Fig. 4 with image from Fu et al., 2022
mid cerebral vein branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg/s843Tg + MO3-rspo1 Fig. 4 with image from Fu et al., 2022
middle mesencephalic central artery absent, abnormal y1Tg/y1Tg + MO3-rspo1 Fig. 4 with image from Gore et al., 2011
posterior mesencephalic central artery absent, abnormal y1Tg/y1Tg + MO3-rspo1 Fig. 4 with image from Gore et al., 2011
somite vegfaa expression decreased amount, abnormal WT + MO3-rspo1 Fig. 4 with image,  Fig. S7 with image from Genthe et al., 2017
somite dlc expression decreased amount, abnormal WT + MO3-rspo1 Fig. 3 with image,  Fig. S5 with image,  Fig. S6 with image from Genthe et al., 2017
somite wnt16 expression decreased amount, abnormal WT + MO3-rspo1 Fig. 2 with image,  Fig. S2 with image from Genthe et al., 2017
somite dld expression decreased amount, abnormal WT + MO3-rspo1 Fig. 3 with image,  Fig. S5 with image,  Fig. S6 with image from Genthe et al., 2017
thymus T cell rag1 expression absent, abnormal WT + MO3-rspo1 Fig. 1 with image,  Fig. 5 with image from Genthe et al., 2017
thymus T cell absent, abnormal WT + MO3-rspo1 Fig. 1 with image,  Fig. 5 with image from Genthe et al., 2017
trunk mesoderm rspo1 expression decreased amount, abnormal WT + MO3-rspo1 Fig. S2 with image from Genthe et al., 2017
vascular cord tgfb1a expression decreased amount, abnormal WT + MO3-rspo1 Fig. 4 with image from Genthe et al., 2017
vascular cord tgfb1b expression decreased amount, abnormal WT + MO3-rspo1 Fig. 4 with image from Genthe et al., 2017
whole organism rspo1 expression decreased amount, abnormal WT + MO3-rspo1 Fig. S1 with image from Genthe et al., 2017
whole organism wnt16 expression decreased amount, abnormal WT + MO3-rspo1 Fig. 2 with image from Genthe et al., 2017
whole organism vegfaa expression decreased amount, abnormal WT + MO3-rspo1 Fig. 4 with image from Genthe et al., 2017
whole organism dlc expression decreased amount, abnormal WT + MO3-rspo1 Fig. 3 with image from Genthe et al., 2017
whole organism dld expression decreased amount, abnormal WT + MO3-rspo1 Fig. 3 with image from Genthe et al., 2017
Phenotype of all Fish created by or utilizing MO3-rspo1
Phenotype Fish Conditions Figures
mid cerebral vein branching involved in blood vessel morphogenesis decreased process quality, ameliorated s843Tg/s843Tg + MO3-rspo1 chemical treatment by environment: N-methyl-N-nitrosourea Fig. 4 with image from Fu et al., 2022
intersegmental vessel branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg/s843Tg + MO3-rspo1 standard conditions Fig. 4 with image from Fu et al., 2022
intersegmental vessel branching involved in blood vessel morphogenesis decreased process quality, ameliorated s843Tg/s843Tg + MO3-rspo1 chemical treatment by environment: N-methyl-N-nitrosourea Fig. 4 with image from Fu et al., 2022
mid cerebral vein branching involved in blood vessel morphogenesis decreased process quality, abnormal s843Tg/s843Tg + MO3-rspo1 standard conditions Fig. 4 with image from Fu et al., 2022
middle mesencephalic central artery absent, abnormal y1Tg/y1Tg + MO3-rspo1 standard conditions Fig. 4 with image from Gore et al., 2011
cerebellar central artery absent, abnormal y1Tg/y1Tg + MO3-rspo1 standard conditions Fig. 4 with image from Gore et al., 2011
posterior mesencephalic central artery absent, abnormal y1Tg/y1Tg + MO3-rspo1 standard conditions Fig. 4 with image from Gore et al., 2011
intersegmental vessel decreased length, abnormal y1Tg/y1Tg + MO3-rspo1 standard conditions Fig. 3 with image from Gore et al., 2011
intersegmental vessel decreased amount, abnormal y1Tg/y1Tg + MO3-rspo1 standard conditions Fig. 4 with image from Gore et al., 2011
angiogenesis disrupted, abnormal y1Tg/y1Tg + MO3-rspo1 standard conditions Fig. 3 with image from Gore et al., 2011
anterior mesencephalic central artery absent, abnormal y1Tg/y1Tg + MO3-rspo1 standard conditions Fig. 4 with image from Gore et al., 2011
whole organism rspo1 expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. S1 with image from Genthe et al., 2017
somite wnt16 expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. 2 with image,  Fig. S2 with image from Genthe et al., 2017
vascular cord tgfb1a expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. 4 with image from Genthe et al., 2017
dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. 1 with image,  Fig. 5 with image from Genthe et al., 2017
whole organism vegfaa expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. 4 with image from Genthe et al., 2017
whole organism wnt16 expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. 2 with image from Genthe et al., 2017
somite vegfaa expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. 4 with image,  Fig. S7 with image from Genthe et al., 2017
whole organism dld expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. 3 with image from Genthe et al., 2017
thymus T cell absent, abnormal WT + MO3-rspo1 standard conditions Fig. 1 with image,  Fig. 5 with image from Genthe et al., 2017
trunk mesoderm rspo1 expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. S2 with image from Genthe et al., 2017
somite dlc expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. 3 with image,  Fig. S5 with image,  Fig. S6 with image from Genthe et al., 2017
dorsal aorta hematopoietic stem cell myb expression absent, abnormal WT + MO3-rspo1 standard conditions Fig. 1 with image from Genthe et al., 2017
somite dld expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. 3 with image,  Fig. S5 with image,  Fig. S6 with image from Genthe et al., 2017
thymus T cell rag1 expression absent, abnormal WT + MO3-rspo1 standard conditions Fig. 1 with image,  Fig. 5 with image from Genthe et al., 2017
dorsal aorta hematopoietic stem cell absent, abnormal WT + MO3-rspo1 standard conditions Fig. 1 with image,  Fig. S2 with image from Genthe et al., 2017
whole organism dlc expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. 3 with image from Genthe et al., 2017
vascular cord tgfb1b expression decreased amount, abnormal WT + MO3-rspo1 standard conditions Fig. 4 with image from Genthe et al., 2017
dorsal aorta hematopoietic stem cell runx1 expression absent, abnormal WT + MO3-rspo1 standard conditions Fig. S2 with image from Genthe et al., 2017
angiogenesis disrupted, abnormal etsrpy11/y11 + MO3-rspo1 standard conditions Fig. 2 with image from Gore et al., 2011
intersegmental vessel decreased length, abnormal etsrpy11/y11 + MO3-rspo1 standard conditions Fig. 2 with image from Gore et al., 2011
intersegmental vessel absent, abnormal y1Tg/y1Tg + MO1-flt4 + MO3-rspo1 standard conditions Fig. 7 with image from Gore et al., 2011
angiogenesis disrupted, abnormal y1Tg/y1Tg + MO1-flt4 + MO3-rspo1 standard conditions Fig. 7 with image from Gore et al., 2011
intersegmental vessel absent, abnormal y1Tg/y1Tg + MO1-vegfc + MO3-rspo1 standard conditions Fig. 7 with image from Gore et al., 2011
angiogenesis disrupted, abnormal y1Tg/y1Tg + MO1-vegfc + MO3-rspo1 standard conditions Fig. 7 with image from Gore et al., 2011
angiogenesis disrupted, abnormal y1Tg/y1Tg + MO1-wnt2bb + MO3-rspo1 standard conditions Fig. 3 with image from Gore et al., 2011
intersegmental vessel absent, abnormal y1Tg/y1Tg + MO1-wnt2bb + MO3-rspo1 standard conditions Fig. 3 with image from Gore et al., 2011
angiogenesis disrupted, abnormal etsrpy11/y11 + MO3-kremen1 + MO3-rspo1 standard conditions Fig. 2 with image from Gore et al., 2011
intersegmental vessel absent, abnormal etsrpy11/y11 + MO3-kremen1 + MO3-rspo1 standard conditions Fig. 2 with image from Gore et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.