Morpholino

MO5-etv5a

ID
ZDB-MRPHLNO-140402-3
Name
MO5-etv5a
Previous Names
None
Target
Sequence
5' - TCACCTGGGTCTTCAAAGAGGCTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-etv5a
Expressed Gene Anatomy Figures
cetn4 Fig. 3 with image from Marra et al., 2016
cimap1b Fig. 3 with image from Marra et al., 2016
eve1 Fig. 4,  Fig. 5 from Chen et al., 2013
foxf1 Fig. S4 from Chen et al., 2013
gata1a Fig. 2 from Chen et al., 2013
gata2a Fig. 2 from Chen et al., 2013
mpx Fig. 2 from Chen et al., 2013
rag1 Fig. 2 from Chen et al., 2013
tal1 Fig. 2 from Chen et al., 2013
Phenotype
Phenotype resulting from MO5-etv5a
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO5-etv5a Fig. 3 from Chen et al., 2013
apoptotic process increased occurrence, abnormal TU + MO5-etv5a Fig. 5 from Chen et al., 2013
blood cell decreased amount, abnormal TU + MO5-etv5a text only from Chen et al., 2013
blood vessel development disrupted, abnormal y1Tg + MO5-etv5a Fig. 3 from Chen et al., 2013
common lymphoid progenitor decreased amount, abnormal TU + MO5-etv5a Fig. 2 from Chen et al., 2013
erythroid lineage cell decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 Fig. 2 from Chen et al., 2013
granulocyte decreased amount, abnormal TU + MO5-etv5a Fig. 2 from Chen et al., 2013
heart contraction decreased rate, abnormal TU + MO5-etv5a text only from Chen et al., 2013
hemangioblast cell differentiation disrupted, abnormal TU + MO5-etv5a + MO5-tp53 Fig. 2 from Chen et al., 2013
hematopoietic stem cell decreased amount, abnormal TU + MO5-etv5a Fig. 2 from Chen et al., 2013
hematopoietic stem cell differentiation disrupted, abnormal TU + MO5-etv5a Fig. 2 from Chen et al., 2013
hemopoiesis disrupted, abnormal TU + MO5-etv5a + MO5-tp53 Fig. 2 from Chen et al., 2013
intersegmental vessel morphology, abnormal y1Tg + MO5-etv5a Fig. 3 from Chen et al., 2013
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO5-etv5a Fig. 3 with image from Marra et al., 2016
pronephric proximal straight tubule has fewer parts of type pronephric proximal straight tubule multi-ciliated epithelial cell, abnormal WT + MO5-etv5a Fig. 3 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal WT + MO5-etv5a Fig. 3 with image from Marra et al., 2016
subintestinal vein hypoplastic, abnormal y1Tg + MO5-etv5a Fig. 3 from Chen et al., 2013
ventral mesoderm cell population proliferation increased occurrence, abnormal TU + MO5-etv5a Fig. 4 from Chen et al., 2013
Phenotype of all Fish created by or utilizing MO5-etv5a
Phenotype Fish Conditions Figures
hemangioblast cell differentiation disrupted, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
blood cell decreased amount, abnormal TU + MO5-etv5a standard conditions text only from Chen et al., 2013
apoptotic process increased occurrence, abnormal TU + MO5-etv5a standard conditions Fig. 5 from Chen et al., 2013
ventral mesoderm cell population proliferation increased occurrence, abnormal TU + MO5-etv5a standard conditions Fig. 4 from Chen et al., 2013
heart contraction decreased rate, abnormal TU + MO5-etv5a standard conditions text only from Chen et al., 2013
hematopoietic stem cell decreased amount, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
hematopoietic stem cell differentiation disrupted, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
erythroid lineage cell decreased amount, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
granulocyte decreased amount, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
common lymphoid progenitor decreased amount, abnormal TU + MO5-etv5a standard conditions Fig. 2 from Chen et al., 2013
common lymphoid progenitor decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hemopoiesis disrupted, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hematopoietic stem cell differentiation disrupted, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hemangioblast cell differentiation disrupted, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
hematopoietic stem cell decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
erythroid lineage cell decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
granulocyte decreased amount, abnormal TU + MO5-etv5a + MO5-tp53 standard conditions Fig. 2 from Chen et al., 2013
pronephric proximal straight tubule has fewer parts of type pronephric proximal straight tubule multi-ciliated epithelial cell, abnormal WT + MO5-etv5a standard conditions Fig. 3 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal WT + MO5-etv5a standard conditions Fig. 3 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO5-etv5a standard conditions Fig. 3 with image from Marra et al., 2016
subintestinal vein hypoplastic, abnormal y1Tg + MO5-etv5a standard conditions Fig. 3 from Chen et al., 2013
blood vessel development disrupted, abnormal y1Tg + MO5-etv5a standard conditions Fig. 3 from Chen et al., 2013
angiogenesis disrupted, abnormal y1Tg + MO5-etv5a standard conditions Fig. 3 from Chen et al., 2013
intersegmental vessel morphology, abnormal y1Tg + MO5-etv5a standard conditions Fig. 3 from Chen et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.