Morpholino

MO2-tnfrsf1b

ID
ZDB-MRPHLNO-130620-1
Name
MO2-tnfrsf1b
Previous Names
  • tnfr2 MO (1)
Target
Sequence
5' - GGAATCTGTGAACACAAAGGGACAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tnfrsf1b
Expressed Gene Anatomy Figures
baxa Fig. 4 with image from Espín et al., 2013
cdkn1a Fig. 4 with image from Espín et al., 2013
dlc Fig. 2 from Espín-Palazón et al., 2014
efnb2a Fig. 2 from Espín-Palazón et al., 2014
foxn1 Fig. 1 from Espín-Palazón et al., 2014
il1b Fig. 6 from Espín-Palazón et al., 2014
jag1a Fig. 4 from Espín-Palazón et al., 2014
kdrl Fig. 2 from Espín-Palazón et al., 2014
mdm2 Fig. 4 with image from Espín et al., 2013
myb Fig. 1 from Espín-Palazón et al., 2014
notch1b Fig. 2 from Espín-Palazón et al., 2014
notch3 Fig. 2 from Espín-Palazón et al., 2014
rag1 Fig. 1 from Espín-Palazón et al., 2014
runx1 Fig. 3,  Fig. 4 from Espín-Palazón et al., 2014
tnfa Fig. 2 with image from Espín et al., 2013
tnfrsf1a Fig. 2 with image from Espín et al., 2013
tp53 Fig. 4 with image from Espín et al., 2013
Phenotype
Phenotype resulting from MO2-tnfrsf1b
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal y1Tg + MO2-tnfrsf1b Fig. 1 with image from Espín et al., 2013
blood circulation disrupted, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b Fig. 1 with image from Espín et al., 2013
caudal hematopoietic tissue hematopoietic multipotent progenitor cell EGFP expression absent, abnormal la2Tg; sd2Tg + MO2-tnfrsf1b Fig. 2 from Espín-Palazón et al., 2014
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; sd2Tg + MO2-tnfrsf1b Fig. 2 from Espín-Palazón et al., 2014
caudal vein malformed, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b Fig. 1 with image from Espín et al., 2013
dorsal root ganglion peripheral nervous system axon ensheathment decreased occurrence, abnormal w9Tg + MO2-tnfrsf1b Fig. 6 with image from Smith et al., 2017
endothelial cell apoptotic, abnormal y1Tg + MO2-tnfrsf1b Fig. 1 with image from Espín et al., 2013
endothelial cell jag1a expression decreased amount, abnormal s896Tg + MO2-tnfrsf1b Fig. 4 from Espín-Palazón et al., 2014
endothelial cell il1b expression decreased amount, abnormal s896Tg + MO2-tnfrsf1b Fig. 6 from Espín-Palazón et al., 2014
glial cell EGFP expression absent, abnormal nc1Tg + MO2-tnfrsf1b Fig. 5 with image from Smith et al., 2017
glial cell Eos expression decreased amount, abnormal w9Tg + MO2-tnfrsf1b Fig. 6 with image from Smith et al., 2017
hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg + MO2-tnfrsf1b Fig. 1 from Espín-Palazón et al., 2014
integument canonical NF-kappaB signal transduction increased process quality, abnormal nc1Tg + MO2-tnfrsf1b Fig. 2 from Martínez-Navarro et al., 2020
integument hydrogen peroxide increased amount, abnormal nz50Tg + MO2-tnfrsf1b Fig. 2 from Martínez-Navarro et al., 2020
integument neutrophil increased amount, abnormal nz50Tg + MO2-tnfrsf1b Fig. 2 from Martínez-Navarro et al., 2020
nucleate erythrocyte increased accumulation dorsal aorta, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b Fig. 1 with image from Espín et al., 2013
nucleate erythrocyte increased accumulation caudal artery, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b Fig. 1 with image from Espín et al., 2013
sprouting angiogenesis disrupted, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b Fig. 1 with image from Espín et al., 2013
T cell rag1 expression absent, abnormal WT + MO2-tnfrsf1b Fig. 1 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta EGFP expression decreased distribution, abnormal s896Tg; um14Tg + MO2-tnfrsf1b Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal WT + MO2-tnfrsf1b Fig. 4 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta myb expression decreased distribution, abnormal WT + MO2-tnfrsf1b Fig. 1 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO2-tnfrsf1b Fig. 1,  Fig. 4 from Espín-Palazón et al., 2014
whole organism hemorrhagic, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b Fig. 1 with image from Espín et al., 2013
Phenotype of all Fish created by or utilizing MO2-tnfrsf1b
Phenotype Fish Conditions Figures
whole organism life span, ameliorated AB + MO2-tnfrsf1b viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 2 from Espín-Palazón et al., 2016
ventral wall of dorsal aorta myb expression decreased distribution, abnormal WT + MO2-tnfrsf1b standard conditions Fig. 1 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal WT + MO2-tnfrsf1b standard conditions Fig. 4 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO2-tnfrsf1b standard conditions Fig. 1,  Fig. 4 from Espín-Palazón et al., 2014
T cell rag1 expression absent, abnormal WT + MO2-tnfrsf1b standard conditions Fig. 1 from Espín-Palazón et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg + MO2-tnfrsf1b standard conditions Fig. 1 from Espín-Palazón et al., 2014
glial cell EGFP expression absent, abnormal nc1Tg + MO2-tnfrsf1b control Fig. 5 with image from Smith et al., 2017
integument canonical NF-kappaB signal transduction process quality, ameliorated nc1Tg + MO2-tnfrsf1b chemical treatment by environment: pyridoxine Fig. 2 from Martínez-Navarro et al., 2020
integument canonical NF-kappaB signal transduction process quality, ameliorated nc1Tg + MO2-tnfrsf1b chemical treatment by environment: pyridoxal 5'-phosphate Fig. 2 from Martínez-Navarro et al., 2020
integument canonical NF-kappaB signal transduction increased process quality, abnormal nc1Tg + MO2-tnfrsf1b standard conditions Fig. 2 from Martínez-Navarro et al., 2020
integument neutrophil amount, ameliorated nz50Tg + MO2-tnfrsf1b chemical treatment by environment: pyridoxine Fig. 2 from Martínez-Navarro et al., 2020
integument hydrogen peroxide increased amount, abnormal nz50Tg + MO2-tnfrsf1b standard conditions Fig. 2 from Martínez-Navarro et al., 2020
integument neutrophil amount, ameliorated nz50Tg + MO2-tnfrsf1b chemical treatment by environment: pyridoxal 5'-phosphate Fig. 2 from Martínez-Navarro et al., 2020
integument neutrophil increased amount, abnormal nz50Tg + MO2-tnfrsf1b standard conditions Fig. 2 from Martínez-Navarro et al., 2020
integument hydrogen peroxide amount, ameliorated nz50Tg + MO2-tnfrsf1b chemical treatment by environment: pyridoxal Fig. 2 from Martínez-Navarro et al., 2020
integument neutrophil amount, ameliorated nz50Tg + MO2-tnfrsf1b chemical treatment by environment: pyridoxal Fig. 2 from Martínez-Navarro et al., 2020
integument hydrogen peroxide amount, ameliorated nz50Tg + MO2-tnfrsf1b chemical treatment by environment: pyridoxal 5'-phosphate Fig. 2 from Martínez-Navarro et al., 2020
endothelial cell il1b expression decreased amount, abnormal s896Tg + MO2-tnfrsf1b standard conditions Fig. 6 from Espín-Palazón et al., 2014
endothelial cell jag1a expression decreased amount, abnormal s896Tg + MO2-tnfrsf1b standard conditions Fig. 4 from Espín-Palazón et al., 2014
dorsal root ganglion peripheral nervous system axon ensheathment decreased occurrence, abnormal w9Tg + MO2-tnfrsf1b control Fig. 6 with image from Smith et al., 2017
glial cell Eos expression decreased amount, abnormal w9Tg + MO2-tnfrsf1b control Fig. 6 with image from Smith et al., 2017
apoptotic process increased occurrence, abnormal y1Tg + MO2-tnfrsf1b standard conditions Fig. 1 with image from Espín et al., 2013
endothelial cell apoptotic, abnormal y1Tg + MO2-tnfrsf1b standard conditions Fig. 1 with image from Espín et al., 2013
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; sd2Tg + MO2-tnfrsf1b standard conditions Fig. 2 from Espín-Palazón et al., 2014
caudal hematopoietic tissue hematopoietic multipotent progenitor cell EGFP expression absent, abnormal la2Tg; sd2Tg + MO2-tnfrsf1b standard conditions Fig. 2 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta EGFP expression decreased distribution, abnormal s896Tg; um14Tg + MO2-tnfrsf1b standard conditions Fig. 3 from Espín-Palazón et al., 2014
sprouting angiogenesis disrupted, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b standard conditions Fig. 1 with image from Espín et al., 2013
nucleate erythrocyte increased accumulation caudal artery, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b standard conditions Fig. 1 with image from Espín et al., 2013
nucleate erythrocyte increased accumulation dorsal aorta, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b standard conditions Fig. 1 with image from Espín et al., 2013
caudal vein malformed, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b standard conditions Fig. 1 with image from Espín et al., 2013
whole organism hemorrhagic, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b standard conditions Fig. 1 with image from Espín et al., 2013
blood circulation disrupted, abnormal sd2Tg; y1Tg + MO2-tnfrsf1b standard conditions Fig. 1 with image from Espín et al., 2013
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, exacerbated WT + MO2-jag1a + MO2-tnfrsf1b standard conditions Fig. 4 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal WT + MO2-jag1a + MO2-tnfrsf1b standard conditions Fig. 4 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO2-tnfrsf1a + MO2-tnfrsf1b standard conditions Fig. 1 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta myb expression decreased distribution, abnormal WT + MO2-tnfrsf1a + MO2-tnfrsf1b standard conditions Fig. 1 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, exacerbated WT + MO2-tnfrsf1b + MO5-notch1a standard conditions Fig. 4 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell amount, ameliorated bw9Tg; kca3Tg + MO2-tnfrsf1b standard conditions Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell amount, ameliorated kca3Tg; kca4Tg + MO2-tnfrsf1b heat shock Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal kca3Tg; kca4Tg + MO2-tnfrsf1b standard conditions Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal kca3Tg; kca4Tg + MO2-tnfrsf1b standard conditions Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO2-tnfrsf1b standard conditions Fig. 1 from Espín-Palazón et al., 2014
hematopoietic stem cell homeostasis decreased occurrence, abnormal s896Tg; zf169Tg + MO2-tnfrsf1b standard conditions Fig. 1 from Espín-Palazón et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.