Morpholino

MO1-tbx5b

ID
ZDB-MRPHLNO-130123-3
Name
MO1-tbx5b
Previous Names
None
Target
Sequence
5' - GGATTCGCCATATTCCCGTCTGAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx5b
Expressed Gene Anatomy Figures
aimp1a Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
bmp4 Fig. 5 with imageFig. 7 with imageFig. 9 with image from Parrie et al., 2013
cox6b1 Fig. 3 with image from Boyle Anderson et al., 2018
cryba1l1 Fig. S5 with image from Boyle Anderson et al., 2018
ctsc Fig. S4 with image from Boyle Anderson et al., 2018
efnb2a Fig. 4 with image from Pi-Roig et al., 2014
ephb2a Fig. 4 with image from Pi-Roig et al., 2014
etv4 Fig. 5 with image from Pi-Roig et al., 2014
fgf10a Fig. 5 with image from Pi-Roig et al., 2014
fgf24 Fig. 5 with image from Pi-Roig et al., 2014
hand2 Fig. 5 with imageFig. 9 with image from Parrie et al., 2013
hey2 Fig. 7 with image from Parrie et al., 2013
hhex Fig. 3 with image from Boyle Anderson et al., 2018
hsp90aa1.2 Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
hspa8b Fig. S4 with image from Boyle Anderson et al., 2018
krt91 Fig. S5 with image from Boyle Anderson et al., 2018
mybphb Fig. S4 with image from Boyle Anderson et al., 2018
myl7 Fig. 2 with image from Pi-Roig et al., 2014
napbb Fig. S5 with image from Boyle Anderson et al., 2018
ndufa4b Fig. S5 with image from Boyle Anderson et al., 2018
nppa Fig. 5 with imageFig. 7 with image from Parrie et al., 2013
obsl1a Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
phlda2 Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
pvalb2 Fig. S4 with image from Boyle Anderson et al., 2018
ryr1b Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
shha Fig. S3 with image from Steimle et al., 2018
si:dkey-204l11.1 Fig. S5 with image from Boyle Anderson et al., 2018
sox7 Fig. 3 with image from Boyle Anderson et al., 2018
tbx2b Fig. 7 with image from Parrie et al., 2013
tbx5a Fig. 5 with image from Pi-Roig et al., 2014
Fig. 7 with image from Parrie et al., 2013
tbx5b Fig. 7 with image from Parrie et al., 2013
tyrp1b Fig. S5 with image from Boyle Anderson et al., 2018
vcana Fig. 5 with imageFig. 9 with image from Parrie et al., 2013
Phenotype
Phenotype resulting from MO1-tbx5b
Phenotype Fish Figures
eye decreased size, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
head decreased size, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
head shape, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
heart malformed, abnormal WT + MO1-tbx5b Fig. 1 with image from Pi-Roig et al., 2014
heart morphology, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
heart structure, abnormal s883Tg + MO1-tbx5b Fig. 4 with imageFig. 10 with image from Parrie et al., 2013
heart contraction decreased rate, abnormal s883Tg + MO1-tbx5b Fig. 4 with image from Parrie et al., 2013
heart development disrupted, abnormal s883Tg + MO1-tbx5b Fig. 4 with imageFig. 10 with image from Parrie et al., 2013
heart jogging disrupted, abnormal WT + MO1-tbx5b Fig. 2 with image from Pi-Roig et al., 2014
heart looping arrested, abnormal WT + MO1-tbx5b Fig. 1 with image from Pi-Roig et al., 2014
heart looping disrupted, abnormal s849Tg; uto1Tg + MO1-tbx5b Fig. 1 with image from Pi-Roig et al., 2014
Fig. 4 with image from Parrie et al., 2013
Fig. S8 with image from Chiavacci et al., 2012
heart looping process quality, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
immature eye cryba1l1 expression decreased amount, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression decreased distribution, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression increased amount, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
pectoral fin decreased size, abnormal WT + MO1-tbx5b Fig. 8 with imageFig. 11 with image from Parrie et al., 2013
pectoral fin immature, abnormal WT + MO1-tbx5b Fig. 5 with image from Pi-Roig et al., 2014
pectoral fin shape, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
pectoral fin shortened, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
pectoral fin development delayed, abnormal WT + MO1-tbx5b Fig. 5 with image from Pi-Roig et al., 2014
pectoral fin development disrupted, abnormal WT + MO1-tbx5b Fig. 8 with imageFig. 11 with image from Parrie et al., 2013
pectoral fin morphogenesis disrupted, abnormal WT + MO1-tbx5b Fig. 8 with image from Parrie et al., 2013
pericardium edematous, abnormal AB + MO1-tbx5b Fig. 1 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression decreased amount, abnormal AB + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression decreased amount, abnormal AB + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression spatial pattern, abnormal AB + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression spatial pattern, abnormal AB + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
pronephros cox6b1 expression decreased amount, abnormal AB + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
somite aimp1a expression decreased amount, abnormal AB + MO1-tbx5b Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite decreased size, abnormal AB + MO1-tbx5b Fig. 4 with image from Boyle Anderson et al., 2018
somite pvalb2 expression increased amount, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased amount, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression increased amount, abnormal AB + MO1-tbx5b Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite mybphb expression increased distribution, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased distribution, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression mislocalised, abnormal AB + MO1-tbx5b Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite medial side ctsc expression increased distribution, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
somite ventral side mybphb expression mislocalised, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
subintestinal vein decreased size, abnormal y1Tg + MO1-tbx5b Fig. 3 with image from Boyle Anderson et al., 2018
swim bladder uninflated, abnormal AB + MO1-tbx5b text only from Boyle Anderson et al., 2018
tail bud napbb expression increased distribution, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
trunk somite obsl1a expression decreased amount, abnormal AB + MO1-tbx5b Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
whole organism dead, abnormal AB + MO1-tbx5b text only from Boyle Anderson et al., 2018
whole organism napbb expression mislocalised, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
whole organism anterior side phlda2 expression decreased amount, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
whole organism posterior region obsl1a expression increased amount, abnormal AB + MO1-tbx5b Fig. S4 with image from Boyle Anderson et al., 2018
yolk napbb expression mislocalised, abnormal AB + MO1-tbx5b Fig. S5 with image from Boyle Anderson et al., 2018
Phenotype of all Fish created by or utilizing MO1-tbx5b
Phenotype Fish Conditions Figures
head decreased size, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
pronephros cox6b1 expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
head shape, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
somite ventral side mybphb expression mislocalised, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite pvalb2 expression increased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression increased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
swim bladder uninflated, abnormal AB + MO1-tbx5b standard conditions text only from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression increased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
immature eye cryba1l1 expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
whole organism posterior region obsl1a expression increased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased distribution, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression spatial pattern, abnormal AB + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
tail bud napbb expression increased distribution, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
pericardium edematous, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
pectoral fin shape, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
somite mybphb expression increased distribution, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
trunk somite obsl1a expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression mislocalised, abnormal AB + MO1-tbx5b standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
pectoral fin shortened, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
somite aimp1a expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite decreased size, abnormal AB + MO1-tbx5b standard conditions Fig. 4 with image from Boyle Anderson et al., 2018
whole organism anterior side phlda2 expression decreased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
whole organism napbb expression mislocalised, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
heart looping process quality, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
eye decreased size, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
somite medial side ctsc expression increased distribution, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
yolk napbb expression mislocalised, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression decreased distribution, abnormal AB + MO1-tbx5b standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression spatial pattern, abnormal AB + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
whole organism dead, abnormal AB + MO1-tbx5b standard conditions text only from Boyle Anderson et al., 2018
heart morphology, abnormal AB + MO1-tbx5b standard conditions Fig. 1 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased amount, abnormal AB + MO1-tbx5b standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
pectoral fin morphogenesis disrupted, abnormal WT + MO1-tbx5b standard conditions Fig. 8 with image from Parrie et al., 2013
heart development disrupted, abnormal WT + MO1-tbx5b standard conditions Fig. 10 with image from Parrie et al., 2013
pectoral fin decreased size, abnormal WT + MO1-tbx5b standard conditions Fig. 8 with imageFig. 11 with image from Parrie et al., 2013
heart malformed, abnormal WT + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
pectoral fin development delayed, abnormal WT + MO1-tbx5b standard conditions Fig. 5 with image from Pi-Roig et al., 2014
pectoral fin immature, abnormal WT + MO1-tbx5b standard conditions Fig. 5 with image from Pi-Roig et al., 2014
heart jogging disrupted, abnormal WT + MO1-tbx5b standard conditions Fig. 2 with image from Pi-Roig et al., 2014
heart structure, abnormal WT + MO1-tbx5b standard conditions Fig. 10 with image from Parrie et al., 2013
heart looping disrupted, abnormal WT + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
pectoral fin development disrupted, abnormal WT + MO1-tbx5b standard conditions Fig. 8 with imageFig. 11 with image from Parrie et al., 2013
heart looping arrested, abnormal WT + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
heart development disrupted, abnormal s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart structure, abnormal s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart looping disrupted, abnormal s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart contraction decreased rate, abnormal s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
subintestinal vein decreased size, abnormal y1Tg + MO1-tbx5b standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
heart looping disrupted, abnormal s849Tg; uto1Tg + MO1-tbx5b standard conditions Fig. S8 with image from Chiavacci et al., 2012
primordial vasculature sox7 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression spatial pattern, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
somite medial side ctsc expression increased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite pvalb2 expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
periderm krt91 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite phlda2 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
tail bud napbb expression increased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
pronephros cox6b1 expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
trunk anterior region mybphb expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
periderm si:dkey-204l11.1 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite ryr1b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
whole organism posterior region mybphb expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite obsl1a expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
immature eye cryba1l1 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
yolk syncytial layer ndufa4b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite aimp1a expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
whole organism phlda2 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite decreased size, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with image from Boyle Anderson et al., 2018
whole organism napbb expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
pronephros anatomical region cox6b1 expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
yolk napbb expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression decreased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression decreased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite mybphb expression spatial pattern, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
heart jogging disrupted, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 2 with image from Pi-Roig et al., 2014
heart malformed, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
heart looping disrupted, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
cranial nerve II decreased thickness, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 4 with image from Pi-Roig et al., 2014
heart looping arrested, abnormal WT + MO1-tbx5a + MO1-tbx5b standard conditions Fig. 1 with image from Pi-Roig et al., 2014
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
subintestinal vein decreased size, abnormal y1Tg + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
heart looping disrupted, abnormal tbx5am21/m21; s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart contraction decreased rate, abnormal tbx5am21/m21; s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart structure, abnormal tbx5am21/m21; s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
heart development disrupted, abnormal tbx5am21/m21; s883Tg + MO1-tbx5b standard conditions Fig. 4 with image from Parrie et al., 2013
Citations