Morpholino
MO4-ptpn11a
- ID
- ZDB-MRPHLNO-101026-5
- Name
- MO4-ptpn11a
- Previous Names
-
- MO4-ptpn11
- Shp2 Ex3-MO (1)
- Target
- Sequence
-
5' - AGGTATGTATGTGCTCACCTCTCGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets exon 3
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-ptpn11a
Expressed Gene | Anatomy | Figures |
---|---|---|
axin2 |
Fig. 4
from Gao et al., 2020 |
|
crestin |
Fig. 3 ![]() |
|
dkk1b |
Fig. 4
from Gao et al., 2020 |
|
dlx2a |
Fig. 3 ![]() |
|
foxd3 |
Fig. 2 ![]() |
1 - 5 of 12 Show all
Phenotype
Phenotype resulting from MO4-ptpn11a
1 - 5 of 33 Show all
Phenotype of all Fish created by or utilizing MO4-ptpn11a
1 - 5 of 34 Show all
Citations
- Gao, X., Huang, S.S., Qiu, S.W., Su, Y., Wang, W.Q., Xu, H.Y., Xu, J.C., Kang, D.Y., Dai, P., Yuan, Y.Y. (2020) Congenital sensorineural hearing loss as the initial presentation of PTPN11-associated Noonan syndrome with multiple lentigines or Noonan syndrome: clinical features and underlying mechanisms. Journal of Medical Genetics. 58(7):465-474
- Stewart, R.A., Sanda, T., Widlund, H.R., Zhu, S., Swanson, K.D., Hurley, A.D., Bentires-Alj, M., Fisher, D.E., Kontaridis, M.I., Look, A.T., and Neel, B.G. (2010) Phosphatase-Dependent and -Independent Functions of Shp2 in Neural Crest Cells Underlie LEOPARD Syndrome Pathogenesis. Developmental Cell. 18(5):750-762
1 - 2 of 2
Show