Morpholino

MO1-camk2g1

ID
ZDB-MRPHLNO-100823-10
Name
MO1-camk2g1
Previous Names
None
Target
Sequence
5' - AATTGTAGCCATGTTGTGTGTGCGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-camk2g1
Expressed Gene Anatomy Figures
cdh17 Fig. 6 with image from Rothschild et al., 2011
dand5 Fig. 5 with image from Francescatto et al., 2010
dla Fig. 6 with image from Rothschild et al., 2013
dld Fig. 6 with image from Rothschild et al., 2013
foxa3 Fig. 3 with image from Francescatto et al., 2010
gata3 Fig. 6 with image from Rothschild et al., 2011
lft1 Fig. 3 with image from Francescatto et al., 2010
myl7 Fig. 3 with image from Francescatto et al., 2010
pax2a Fig. 6 with image from Rothschild et al., 2013
Fig. 6 with image from Rothschild et al., 2011
ret Fig. 6 with image from Rothschild et al., 2011
tbxta Fig. 5 with image from Francescatto et al., 2010
wt1a Fig. 6 with image from Rothschild et al., 2011
Phenotype
Phenotype resulting from MO1-camk2g1
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO1-camk2g1 Fig. 4 with image from Rothschild et al., 2011
calcium/calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO1-camk2g1 Fig. 3 with image,  Fig. 7 with image from Francescatto et al., 2010
cell migration involved in kidney development disrupted, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2011
cell migration involved in metanephros development disrupted, abnormal WIK/AB + MO1-camk2g1 Fig. 6 from Rothschild et al., 2020
cloaca morphology, abnormal WIK/AB + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2020
cloaca cilium decreased amount, abnormal WT + MO1-camk2g1 Fig. 6 with image from Rothschild et al., 2018
cloaca cilium decreased length, abnormal WT + MO1-camk2g1 Fig. 6 with image from Rothschild et al., 2018
cloacal chamber cilium decreased amount, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2011
cloacal chamber cilium decreased length, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2011
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
determination of left/right asymmetry in diencephalon disrupted, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-camk2g1 Fig. 6 with image from Francescatto et al., 2010
determination of liver left/right asymmetry disrupted, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
digestive system centered, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
digestive system inverted, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
epithalamus aplastic, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
epithalamus bilateral, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
epithalamus inverted, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
glomerular filtration disrupted, abnormal WT + MO1-camk2g1 Fig. 4 with image from Rothschild et al., 2011
hair cell anterior macula kinocilium decreased amount, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2013
hair cell anterior macula kinocilium deformed, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2013
heart jogging disrupted, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
heart tube centered, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
heart tube inverted, abnormal WT + MO1-camk2g1 Fig. 3 with image from Francescatto et al., 2010
inner ear posterior-most region increased distance pronephric duct anterior-most region, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2011
Kupffer's vesicle decreased size, abnormal WT + MO1-camk2g1 Fig. 5 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-camk2g1 Fig. 5 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-camk2g1 Fig. 5 with image from Francescatto et al., 2010
otic vesicle decreased length, abnormal WT + MO1-camk2g1 Fig. 2 with image from Rothschild et al., 2013
otic vesicle kinocilium increased amount, abnormal WT + MO1-camk2g1 Fig. 4 with image,  Fig. 6 with image from Rothschild et al., 2013
otolith decreased size, abnormal WIK/AB + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2020
Fig. 2 with image from Rothschild et al., 2013
otolith mislocalised, abnormal WT + MO1-camk2g1 Fig. 2 with image from Rothschild et al., 2013
otolith morphology, abnormal WT + MO1-camk2g1 Fig. 2 with image from Rothschild et al., 2013
post-vent region curved, abnormal WIK/AB + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2020
posterior crista kinocilium decreased amount, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2013
posterior crista kinocilium deformed, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2013
pronephric duct morphology, abnormal WIK/AB + MO1-camk2g1 Fig. 6 from Rothschild et al., 2020
pronephric duct distal region obstructed, abnormal zf34Tg + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2011
pronephric podocyte unfused from pronephric podocyte, abnormal WT + MO1-camk2g1 Fig. 6 with image from Rothschild et al., 2011
pronephros cystic, abnormal WT + MO1-camk2g1 Fig. 4 with image from Rothschild et al., 2011
pronephros anterior region structure, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2011
pronephros anterior region truncated, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2011
pronephros development process quality, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2018
pronephros morphogenesis process quality, abnormal WT + MO1-camk2g1 Fig. 5 with image from Rothschild et al., 2018
protein autophosphorylation decreased occurrence, abnormal WT + MO1-camk2g1 Fig. 7 with image from Francescatto et al., 2010
whole organism anterior-posterior axis condensed, abnormal WT + MO1-camk2g1 Fig. 4 with image from Rothschild et al., 2011
Phenotype of all Fish created by or utilizing MO1-camk2g1
Phenotype Fish Conditions Figures
cell migration involved in metanephros development disrupted, abnormal WIK/AB + MO1-camk2g1 standard conditions Fig. 6 from Rothschild et al., 2020
otolith decreased size, abnormal WIK/AB + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2020
cloaca morphology, abnormal WIK/AB + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2020
post-vent region curved, abnormal WIK/AB + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2020
pronephric duct morphology, abnormal WIK/AB + MO1-camk2g1 standard conditions Fig. 6 from Rothschild et al., 2020
hair cell anterior macula kinocilium decreased amount, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2013
cloacal chamber cilium decreased length, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2011
otolith morphology, abnormal WT + MO1-camk2g1 standard conditions Fig. 2 with image from Rothschild et al., 2013
heart tube inverted, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
otolith decreased size, abnormal WT + MO1-camk2g1 standard conditions Fig. 2 with image from Rothschild et al., 2013
otolith mislocalised, abnormal WT + MO1-camk2g1 standard conditions Fig. 2 with image from Rothschild et al., 2013
pronephros cystic, abnormal WT + MO1-camk2g1 standard conditions Fig. 4 with image from Rothschild et al., 2011
digestive system inverted, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
cell migration involved in kidney development disrupted, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2011
digestive system centered, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
pronephric podocyte unfused from pronephric podocyte, abnormal WT + MO1-camk2g1 standard conditions Fig. 6 with image from Rothschild et al., 2011
heart jogging disrupted, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
whole organism anterior-posterior axis condensed, abnormal WT + MO1-camk2g1 standard conditions Fig. 4 with image from Rothschild et al., 2011
glomerular filtration disrupted, abnormal WT + MO1-camk2g1 standard conditions Fig. 4 with image from Rothschild et al., 2011
hair cell anterior macula kinocilium deformed, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2013
brain hydrocephalic, abnormal WT + MO1-camk2g1 standard conditions Fig. 4 with image from Rothschild et al., 2011
pronephros anterior region truncated, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2011
cloaca cilium decreased amount, abnormal WT + MO1-camk2g1 standard conditions Fig. 6 with image from Rothschild et al., 2018
Kupffer's vesicle decreased size, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Francescatto et al., 2010
otic vesicle kinocilium increased amount, abnormal WT + MO1-camk2g1 standard conditions Fig. 4 with image,  Fig. 6 with image from Rothschild et al., 2013
pronephros development process quality, ameliorated WT + MO1-camk2g1 chemical treatment by environment: trichostatin A Fig. 5 with image from Rothschild et al., 2018
determination of left/right asymmetry in diencephalon disrupted, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
otic vesicle decreased length, abnormal WT + MO1-camk2g1 standard conditions Fig. 2 with image from Rothschild et al., 2013
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-camk2g1 standard conditions Fig. 6 with image from Francescatto et al., 2010
pronephros development process quality, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2018
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
pronephros morphogenesis process quality, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2018
protein autophosphorylation decreased occurrence, abnormal WT + MO1-camk2g1 standard conditions Fig. 7 with image from Francescatto et al., 2010
calcium/calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image,  Fig. 7 with image from Francescatto et al., 2010
heart tube centered, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
epithalamus aplastic, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
cloacal chamber cilium decreased amount, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2011
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
cloaca cilium length, ameliorated WT + MO1-camk2g1 chemical treatment by environment: trichostatin A Fig. 6 with image from Rothschild et al., 2018
inner ear posterior-most region increased distance pronephric duct anterior-most region, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2011
pronephros anterior region structure, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2011
cloaca cilium decreased length, abnormal WT + MO1-camk2g1 standard conditions Fig. 6 with image from Rothschild et al., 2018
posterior crista kinocilium decreased amount, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2013
epithalamus inverted, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
determination of liver left/right asymmetry disrupted, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
cloaca cilium amount, ameliorated WT + MO1-camk2g1 chemical treatment by environment: trichostatin A Fig. 6 with image from Rothschild et al., 2018
epithalamus bilateral, abnormal WT + MO1-camk2g1 standard conditions Fig. 3 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Francescatto et al., 2010
pronephros morphogenesis process quality, ameliorated WT + MO1-camk2g1 chemical treatment by environment: trichostatin A Fig. 5 with image from Rothschild et al., 2018
posterior crista kinocilium deformed, abnormal WT + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2013
pronephric duct distal region obstructed, abnormal zf34Tg + MO1-camk2g1 standard conditions Fig. 5 with image from Rothschild et al., 2011
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-camk2g1 + MO2-camk2a standard conditions Fig. 6 with image from Francescatto et al., 2010
cloacal chamber cilium decreased amount, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
pronephros anterior region structure, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
cell migration involved in kidney development disrupted, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
inner ear posterior-most region increased distance pronephric duct anterior-most region, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
pronephros anterior region truncated, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
cloacal chamber cilium decreased length, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
pronephric duct distal region obstructed, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
pronephros development process quality, exacerbated WT + MO1-camk2g1 + MO4-hdac5 standard conditions Fig. 5 with image from Rothschild et al., 2018
cloaca cilium decreased length, abnormal WT + MO1-camk2g1 + MO4-hdac5 standard conditions Fig. 6 with image from Rothschild et al., 2018
pronephros morphogenesis process quality, exacerbated WT + MO1-camk2g1 + MO4-hdac5 standard conditions Fig. 5 with image from Rothschild et al., 2018
cloaca cilium decreased amount, abnormal WT + MO1-camk2g1 + MO4-hdac5 standard conditions Fig. 6 with image from Rothschild et al., 2018
pronephros morphogenesis process quality, ameliorated WT + MO1-camk2g1 + MO6-hdac4 standard conditions Fig. 5 with image from Rothschild et al., 2018
cloaca cilium length, ameliorated WT + MO1-camk2g1 + MO6-hdac4 standard conditions Fig. 6 with image from Rothschild et al., 2018
pronephros development process quality, ameliorated WT + MO1-camk2g1 + MO6-hdac4 standard conditions Fig. 5 with image from Rothschild et al., 2018
cloaca cilium amount, ameliorated WT + MO1-camk2g1 + MO6-hdac4 standard conditions Fig. 6 with image from Rothschild et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.