Morpholino

MO1-mir145

ID
ZDB-MRPHLNO-091106-2
Name
MO1-mir145
Previous Names
  • miR-145 MO (1)
Target
Sequence
5' - TTGCCCAAGGGATTCCTGGGAAAACTGGACC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir145
Expressed Gene Anatomy Figures
acta2 Fig. 1 with image from Zeng et al., 2009
bmp2a Fig. S1 with image from Zeng et al., 2012
bmp2b Fig. S1 with image from Zeng et al., 2012
bmp4 Fig. 2 with image from Zeng et al., 2012
gata6 Fig. 3 with image,  Fig. S5 with image from Zeng et al., 2009
ihha Fig. S1 with image from Zeng et al., 2012
klf5a Fig. 5 with image from Zeng et al., 2012
myh10 Fig. S2 with image from Zeng et al., 2009
shha Fig. 2 with image from Zeng et al., 2012
smtnb Fig. S2 with image from Zeng et al., 2009
tagln Fig. 1 with image,  Fig. S2 with image from Zeng et al., 2009
Phenotype
Phenotype resulting from MO1-mir145
Phenotype Fish Figures
cell population proliferation decreased rate, abnormal TL + MO1-mir145 Fig. 1 with image from Zeng et al., 2012
fourth ventricle hydrocephalic, abnormal WT + MO1-mir145 Fig. 1 with image from Zeng et al., 2009
gut decreased functionality, abnormal TL + MO1-mir145 Fig. 1 with image from Zeng et al., 2012
gut deformed, abnormal WT + MO1-mir145 Fig. 3 with image from Zeng et al., 2009
gut immature, abnormal WT + MO1-mir145 Fig. 1 with image,  Fig. S1 with image,  Fig. S4 with image from Zeng et al., 2009
gut epithelial cell circular, abnormal WT + MO1-mir145 Fig. S4 with image from Zeng et al., 2009
gut smooth muscle cell disorganized, abnormal WT + MO1-mir145 Fig. S4 with image from Zeng et al., 2009
gut epithelium morphology, abnormal TL + MO1-mir145 Fig. 1 with image from Zeng et al., 2012
gut epithelium intestinal villus absent, abnormal WT + MO1-mir145 Fig. 1 with image from Zeng et al., 2009
heart malformed, abnormal WT + MO1-mir145 Fig. 1 with image from Zeng et al., 2009
heart contraction delayed, abnormal WT + MO1-mir145 text only from Zeng et al., 2009
pericardium edematous, abnormal WT + MO1-mir145 Fig. 1 with image,  Fig. S1 with image from Zeng et al., 2009
swim bladder non-functional, abnormal WT + MO1-mir145 Fig. 1 with image from Zeng et al., 2009
Phenotype of all Fish created by or utilizing MO1-mir145
Phenotype Fish Conditions Figures
gut epithelium morphology, abnormal TL + MO1-mir145 standard conditions Fig. 1 with image from Zeng et al., 2012
cell population proliferation decreased rate, abnormal TL + MO1-mir145 standard conditions Fig. 1 with image from Zeng et al., 2012
gut decreased functionality, abnormal TL + MO1-mir145 standard conditions Fig. 1 with image from Zeng et al., 2012
gut deformed, abnormal WT + MO1-mir145 standard conditions Fig. 3 with image from Zeng et al., 2009
heart contraction delayed, abnormal WT + MO1-mir145 standard conditions text only from Zeng et al., 2009
fourth ventricle hydrocephalic, abnormal WT + MO1-mir145 standard conditions Fig. 1 with image from Zeng et al., 2009
gut smooth muscle cell disorganized, abnormal WT + MO1-mir145 standard conditions Fig. S4 with image from Zeng et al., 2009
gut epithelial cell circular, abnormal WT + MO1-mir145 standard conditions Fig. S4 with image from Zeng et al., 2009
heart malformed, abnormal WT + MO1-mir145 standard conditions Fig. 1 with image from Zeng et al., 2009
swim bladder non-functional, abnormal WT + MO1-mir145 standard conditions Fig. 1 with image from Zeng et al., 2009
pericardium edematous, abnormal WT + MO1-mir145 standard conditions Fig. 1 with image,  Fig. S1 with image from Zeng et al., 2009
gut epithelium intestinal villus absent, abnormal WT + MO1-mir145 standard conditions Fig. 1 with image from Zeng et al., 2009
gut immature, abnormal WT + MO1-mir145 standard conditions Fig. 1 with image,  Fig. S1 with image,  Fig. S4 with image from Zeng et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.