Morpholino

MO1-gpr161b

ID

ZDB-MRPHLNO-090206-5

Name

MO1-gpr161b

Previous Names

Target

Sequence

5' - CGTCCCATTCTTAGAGCCGTTCATT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

ATG-targeting morpholino

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gpr161b

Expressed Gene	Anatomy	Figures
bmp4	heart rudiment heart tube	Fig. 4 from Leung et al., 2008
foxa3	gut liver pancreatic bud	Fig. 5 from Leung et al., 2008
lft1	(not) diencephalon notochord	Fig. 3 from Leung et al., 2008
lft2	(not) anterior lateral plate mesoderm	Fig. 3 from Leung et al., 2008
myl7	presumptive atrium heart tube presumptive cardiac ventricle heart tube	Fig. S3 from Leung et al., 2008
nkx2.5	lateral mesoderm	Fig. S4 from Leung et al., 2008
spaw	anterior lateral plate mesoderm	Fig. 3 from Leung et al., 2008
tbxta	notochord	Fig. 3 from Leung et al., 2008

Phenotype

Phenotype resulting from MO1-gpr161b

Phenotype	Fish	Figures
anterior lateral plate mesoderm morphology, abnormal	WT + MO1-gpr161b	Fig. 3 from Leung et al., 2008
calcium ion transport disrupted, abnormal	WT + MO1-gpr161b	Fig. 6 , Fig. S5 from Leung et al., 2008
cardiac ventricle orientation atrium, abnormal	WT + MO1-gpr161b	Fig. S3 from Leung et al., 2008
determination of left/right symmetry disrupted, abnormal	WT + MO1-gpr161b	Fig. 3 , Fig. 4 , Fig. 5 from Leung et al., 2008
diencephalon morphology, abnormal	WT + MO1-gpr161b	Fig. 3 from Leung et al., 2008
embryonic digestive tract morphogenesis disrupted, abnormal	WT + MO1-gpr161b	Fig. 5 from Leung et al., 2008
heart looping disrupted, abnormal	WT + MO1-gpr161b	Fig. S3 from Leung et al., 2008
heart morphogenesis disrupted, abnormal	WT + MO1-gpr161b	Fig. 4 from Leung et al., 2008
heart rudiment morphology, abnormal	WT + MO1-gpr161b	Fig. 4 from Leung et al., 2008
heart tube morphology, abnormal	WT + MO1-gpr161b	Fig. 4 from Leung et al., 2008
liver mislocalised, abnormal	WT + MO1-gpr161b	Fig. 5 from Leung et al., 2008
pancreatic bud mislocalised, abnormal	WT + MO1-gpr161b	Fig. 5 from Leung et al., 2008

Phenotype of all Fish created by or utilizing MO1-gpr161b

Phenotype	Fish	Conditions	Figures
cardiac ventricle orientation atrium, abnormal	WT + MO1-gpr161b	standard conditions	Fig. S3 from Leung et al., 2008
heart rudiment morphology, abnormal	WT + MO1-gpr161b	standard conditions	Fig. 4 from Leung et al., 2008
anterior lateral plate mesoderm morphology, abnormal	WT + MO1-gpr161b	standard conditions	Fig. 3 from Leung et al., 2008
liver mislocalised, abnormal	WT + MO1-gpr161b	standard conditions	Fig. 5 from Leung et al., 2008
pancreatic bud mislocalised, abnormal	WT + MO1-gpr161b	standard conditions	Fig. 5 from Leung et al., 2008
heart tube morphology, abnormal	WT + MO1-gpr161b	standard conditions	Fig. 4 from Leung et al., 2008
heart morphogenesis disrupted, abnormal	WT + MO1-gpr161b	standard conditions	Fig. 4 from Leung et al., 2008
diencephalon morphology, abnormal	WT + MO1-gpr161b	standard conditions	Fig. 3 from Leung et al., 2008
calcium ion transport disrupted, abnormal	WT + MO1-gpr161b	standard conditions	Fig. 6 , Fig. S5 from Leung et al., 2008
determination of left/right symmetry disrupted, abnormal	WT + MO1-gpr161b	standard conditions	Fig. 3 , Fig. 4 , Fig. 5 from Leung et al., 2008
embryonic digestive tract morphogenesis disrupted, abnormal	WT + MO1-gpr161b	standard conditions	Fig. 5 from Leung et al., 2008
heart looping disrupted, abnormal	WT + MO1-gpr161b	standard conditions	Fig. S3 from Leung et al., 2008

Citations