Morpholino

MO1-prickle1a

ID
ZDB-MRPHLNO-060209-7
Name
MO1-prickle1a
Previous Names
  • MO1-prickle1
  • pk1-Mo (1)
  • pk1aMOATG1 (1)
Target
Sequence
5' - GCCCACCGTGATTCTCCAGCTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-start blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prickle1a
Expressed Gene Anatomy Figures
bmp2b Fig. 2 with image from Carreira-Barbosa et al., 2003
chrd Fig. 2 with image from Carreira-Barbosa et al., 2003
ctslb Fig. 2 with image,  Fig. 3 with image from Carreira-Barbosa et al., 2003
dlx3b Fig. 2 with image,  Fig. 3 with image from Carreira-Barbosa et al., 2003
egr2b Fig. 3 with image from Kishimoto et al., 2008
Fig. 6 with image,  Fig. 7 with image from Carreira-Barbosa et al., 2003
emx3 Fig. 2 with image from Carreira-Barbosa et al., 2003
hoxb1a Fig. 7 with image from Carreira-Barbosa et al., 2003
myl7 Fig. 3 with image from Oteiza et al., 2010
myod1 Fig. 3 with image from Kishimoto et al., 2008
Fig. 4 with image,  Fig. 6 with image from Carreira-Barbosa et al., 2003
pax2a Fig. 2 with image from Carreira-Barbosa et al., 2003
pcdh8 Fig. 2 with image from Carreira-Barbosa et al., 2003
rx3 Fig. 2 with image from Carreira-Barbosa et al., 2003
snai1b Fig. 2 with image from Carreira-Barbosa et al., 2003
tbxta Fig. 2 with image,  Fig. 3 with image from Carreira-Barbosa et al., 2003
Phenotype
Phenotype resulting from MO1-prickle1a
Phenotype Fish Figures
cardiac muscle cell orientation heart tube, abnormal WT + MO1-prickle1a Fig. 3 from Merks et al., 2018
cardiac muscle cell establishment of animal organ orientation process quality, abnormal WT + MO1-prickle1a Fig. 3 from Merks et al., 2018
cell migration involved in gastrulation disrupted, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
cell-cell adhesion disrupted, abnormal s870Tg + MO1-prickle1a Fig. 6 with image from Oteiza et al., 2010
convergent extension process quality, abnormal WT + MO1-prickle1a Fig. 1 with image from Dohn et al., 2013
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-prickle1a Fig. 6 with image from Carreira-Barbosa et al., 2003
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-prickle1a Fig. 2 with image,  Fig. 4 with image from Carreira-Barbosa et al., 2003
convergent extension involved in gastrulation process quality, abnormal WT + MO1-prickle1a Fig. 4 from Burcklé et al., 2011
establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-prickle1a Fig. 6 from Jerber et al., 2014
fluid transport disrupted, abnormal WT + MO1-prickle1a Fig. 2 with image from Oteiza et al., 2010
forerunner cell group disorganized, abnormal s870Tg + MO1-prickle1a Fig. 4 with image from Oteiza et al., 2010
forerunner cell group increased width, abnormal s870Tg + MO1-prickle1a Fig. 4 with image from Oteiza et al., 2010
forerunner cell group malformed, abnormal s870Tg + MO1-prickle1a Fig. 4 with image from Oteiza et al., 2010
forerunner cell group shape, abnormal s870Tg + MO1-prickle1a Fig. 4 with image from Oteiza et al., 2010
head mesoderm increased width, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
heart looping disrupted, abnormal WT + MO1-prickle1a Fig. 3 with image from Oteiza et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO1-prickle1a Fig. 1 with image,  Fig. 2 with image from Oteiza et al., 2010
Kupffer's vesicle deformed, abnormal WT + MO1-prickle1a Fig. 1 with image,  Fig. 2 with image,  Fig. 4 with image from Oteiza et al., 2010
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-prickle1a Fig. 2 with image from Oteiza et al., 2010
Kupffer's vesicle development disrupted, abnormal WT + MO1-prickle1a Fig. 1 with image,  Fig. 2 with image,  Fig. 4 with image from Oteiza et al., 2010
neural plate increased width, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
neuron migration disrupted, abnormal rw0Tg + MO1-prickle1a Fig. 7 with image from Carreira-Barbosa et al., 2003
neuron projection morphogenesis disrupted, abnormal knu3Tg + MO1-prickle1a Fig. 4 with image from Mei et al., 2013
notochord decreased length, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
notochord increased width, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
post-vent region curved ventral, abnormal WT + MO1-prickle1a Fig. 2 with image,  Fig. 6 with image from Carreira-Barbosa et al., 2003
post-vent region decreased length, abnormal WT + MO1-prickle1a Fig. 6 with image from Carreira-Barbosa et al., 2003
prechordal plate mislocalised posteriorly, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
pronephros cystic, abnormal WT + MO1-prickle1a Fig. 6 from Jerber et al., 2014
retinal inner plexiform layer disorganized, abnormal knu3Tg + MO1-prickle1a Fig. 4 with image from Mei et al., 2013
retinal inner plexiform layer synapse disorganized, abnormal knu3Tg + MO1-prickle1a Fig. 4 with image from Mei et al., 2013
rhombomere condensed, abnormal WT + MO1-prickle1a Fig. 6 with image from Carreira-Barbosa et al., 2003
segmental plate increased width, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
somite condensed, abnormal WT + MO1-prickle1a Fig. 6 with image from Carreira-Barbosa et al., 2003
somite decreased thickness, abnormal WT + MO1-prickle1a Fig. 4 with image from Carreira-Barbosa et al., 2003
somite increased width, abnormal WT + MO1-prickle1a Fig. 4 with image,  Fig. 6 with image from Carreira-Barbosa et al., 2003
spinal cord duplicated, abnormal WT + MO1-prickle1a Fig. S7 from Tawk et al., 2007
trunk condensed, abnormal WT + MO1-prickle1a Fig. 2 with image from Carreira-Barbosa et al., 2003
whole organism curved ventral, abnormal AB/TU + MO1-prickle1a Fig. 3 with image from Kishimoto et al., 2008
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-prickle1a Fig. 4 with image from Carreira-Barbosa et al., 2003
Phenotype of all Fish created by or utilizing MO1-prickle1a
Phenotype Fish Conditions Figures
whole organism curved ventral, abnormal AB/TU + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
somite increased width, abnormal WT + MO1-prickle1a standard conditions Fig. 4 with image,  Fig. 6 with image from Carreira-Barbosa et al., 2003
heart looping disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 3 with image from Oteiza et al., 2010
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Oteiza et al., 2010
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image,  Fig. 4 with image from Carreira-Barbosa et al., 2003
Kupffer's vesicle deformed, abnormal WT + MO1-prickle1a standard conditions Fig. 1 with image,  Fig. 2 with image from Oteiza et al., 2010
establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 6 from Jerber et al., 2014
cardiac muscle cell orientation heart tube, abnormal WT + MO1-prickle1a control Fig. 3 from Merks et al., 2018
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
post-vent region decreased length, abnormal WT + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
notochord decreased length, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
convergent extension involved in gastrulation process quality, abnormal WT + MO1-prickle1a standard conditions Fig. 4 from Burcklé et al., 2011
head mesoderm increased width, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
trunk condensed, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
somite condensed, abnormal WT + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
cardiac muscle cell establishment of animal organ orientation process quality, abnormal WT + MO1-prickle1a control Fig. 3 from Merks et al., 2018
neural plate increased width, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
cell migration involved in gastrulation disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
Kupffer's vesicle development disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 1 with image,  Fig. 2 with image from Oteiza et al., 2010
segmental plate increased width, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
pronephros cystic, abnormal WT + MO1-prickle1a standard conditions Fig. 6 from Jerber et al., 2014
fluid transport disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Oteiza et al., 2010
somite decreased thickness, abnormal WT + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
notochord increased width, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
spinal cord duplicated, abnormal WT + MO1-prickle1a standard conditions Fig. S7 from Tawk et al., 2007
convergent extension process quality, abnormal WT + MO1-prickle1a standard conditions Fig. 1 with image from Dohn et al., 2013
rhombomere condensed, abnormal WT + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
post-vent region curved ventral, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image,  Fig. 6 with image from Carreira-Barbosa et al., 2003
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
prechordal plate mislocalised posteriorly, abnormal WT + MO1-prickle1a standard conditions Fig. 2 with image from Carreira-Barbosa et al., 2003
Kupffer's vesicle decreased size, abnormal WT + MO1-prickle1a standard conditions Fig. 1 with image,  Fig. 2 with image from Oteiza et al., 2010
neuron projection morphogenesis disrupted, abnormal knu3Tg + MO1-prickle1a standard conditions Fig. 4 with image from Mei et al., 2013
retinal inner plexiform layer synapse disorganized, abnormal knu3Tg + MO1-prickle1a standard conditions Fig. 4 with image from Mei et al., 2013
retinal inner plexiform layer disorganized, abnormal knu3Tg + MO1-prickle1a standard conditions Fig. 4 with image from Mei et al., 2013
neuron migration disrupted, abnormal rw0Tg + MO1-prickle1a standard conditions Fig. 7 with image from Carreira-Barbosa et al., 2003
Kupffer's vesicle development disrupted, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
forerunner cell group shape, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
forerunner cell group increased width, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
forerunner cell group malformed, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
Kupffer's vesicle deformed, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
cell-cell adhesion disrupted, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 6 with image from Oteiza et al., 2010
forerunner cell group disorganized, abnormal s870Tg + MO1-prickle1a standard conditions Fig. 4 with image from Oteiza et al., 2010
somite condensed, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
rhombomere condensed, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
post-vent region curved ventral, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
convergent extension involved in axis elongation disrupted, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
somite increased width, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
post-vent region decreased length, abnormal vangl2m209/+ + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
post-vent region decreased length, abnormal vangl2m209/m209 + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
rhombomere condensed, abnormal vangl2m209/m209 + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
convergent extension involved in axis elongation disrupted, abnormal vangl2m209/m209 + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
somite increased width, abnormal vangl2m209/m209 + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
somite condensed, abnormal vangl2m209/m209 + MO1-prickle1a standard conditions Fig. 6 with image from Carreira-Barbosa et al., 2003
somite condensed, abnormal wnt5bta98/ta98 + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
somite increased width, abnormal wnt5bta98/ta98 + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
convergent extension involved in gastrulation disrupted, abnormal wnt5bta98/ta98 + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
whole organism anterior-posterior axis decreased length, abnormal wnt5bta98/ta98 + MO1-prickle1a standard conditions Fig. 4 with image from Carreira-Barbosa et al., 2003
Kupffer's vesicle development disrupted, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 1 with image from Oteiza et al., 2010
Kupffer's vesicle decreased size, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 1 with image from Oteiza et al., 2010
prechordal plate mislocalised posteriorly, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 3 with image from Carreira-Barbosa et al., 2003
heart looping disrupted, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 3 with image from Oteiza et al., 2010
convergent extension involved in gastrulation disrupted, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 3 with image from Carreira-Barbosa et al., 2003
Kupffer's vesicle deformed, abnormal wnt11f2tx226/tx226 + MO1-prickle1a standard conditions Fig. 1 with image from Oteiza et al., 2010
whole organism curved ventral, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 5 increased width, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
whole organism decreased length, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
somite increased width, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
convergent extension involved in gastrulation disrupted, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 3 increased width, abnormal AB/TU + MO1-dnaaf11 + MO1-prickle1a standard conditions Fig. 3 with image from Kishimoto et al., 2008
whole organism decreased length, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
convergent extension involved in gastrulation disrupted, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 5 increased width, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
somite increased width, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
whole organism curved ventral, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 3 increased width, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
convergent extension involved in gastrulation process quality, abnormal WT + MO1-nphp4 + MO1-prickle1a standard conditions Fig. 4 from Burcklé et al., 2011
pronephros cystic, abnormal WT + MO1-prickle1a + MO2-odad3 standard conditions Fig. 6 from Jerber et al., 2014
establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-prickle1a + MO2-odad3 standard conditions Fig. 6 from Jerber et al., 2014
Kupffer's vesicle development disrupted, abnormal s870Tg; vu119Tg + MO1-prickle1a standard conditions Fig. 5 with image from Oteiza et al., 2010
Kupffer's vesicle deformed, abnormal s870Tg; vu119Tg + MO1-prickle1a standard conditions Fig. 5 with image from Oteiza et al., 2010
Kupffer's vesicle decreased size, abnormal s870Tg; vu119Tg + MO1-prickle1a standard conditions Fig. 5 with image from Oteiza et al., 2010
neuron migration disrupted, abnormal vangl2m209/+; rw0Tg + MO1-prickle1a standard conditions Fig. 7 with image from Carreira-Barbosa et al., 2003
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.