Morpholino

MO1-itgb2

ID
ZDB-MRPHLNO-191003-3
Name
MO1-itgb2
Previous Names
None
Target
Sequence
5' - CATCTCAGTTGTTGAAATGCAACGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-itgb2
Expressed Gene Anatomy Figures
coro1a Fig. S6 with image from Xue et al., 2019
gata1a Fig. S6 with image from Xue et al., 2019
mfap4.1 Fig. S6 with image from Xue et al., 2019
myb Fig. S6 with image from Xue et al., 2019
runx1 Fig. S6 with image from Xue et al., 2019
spi1b Fig. S6 with image from Xue et al., 2019
Phenotype
Phenotype resulting from MO1-itgb2
Phenotype Fish Figures
caudal hematopoietic tissue coro1a expression increased amount, abnormal TU + MO1-itgb2 Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue mfap4.1 expression increased amount, abnormal TU + MO1-itgb2 Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue gata1a expression increased amount, abnormal TU + MO1-itgb2 Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue GFP expression increased amount, abnormal ioz1Tg; pku6Tg + MO1-itgb2 Fig. 5 with image from Xue et al., 2019
caudal hematopoietic tissue myb expression increased amount, abnormal TU + MO1-itgb2 Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue GFP expression increased distribution, abnormal ioz1Tg; pku6Tg + MO1-itgb2 Fig. 5 with image from Xue et al., 2019
caudal hematopoietic tissue hematopoietic cell increased amount, abnormal ioz1Tg; pku6Tg + MO1-itgb2 Fig. 5 with image from Xue et al., 2019
whole organism spi1b expression increased amount, abnormal TU + MO1-itgb2 Fig. S6 with image from Xue et al., 2019
whole organism gata1a expression increased amount, abnormal TU + MO1-itgb2 Fig. S6 with image from Xue et al., 2019
whole organism myb expression increased amount, abnormal TU + MO1-itgb2 Fig. S6 with image from Xue et al., 2019
Phenotype of all Fish created by or utilizing MO1-itgb2
Phenotype Fish Conditions Figures
whole organism gata1a expression increased amount, abnormal TU + MO1-itgb2 control Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue mfap4.1 expression increased amount, abnormal TU + MO1-itgb2 control Fig. S6 with image from Xue et al., 2019
whole organism myb expression increased amount, abnormal TU + MO1-itgb2 control Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue gata1a expression increased amount, abnormal TU + MO1-itgb2 control Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue myb expression increased amount, abnormal TU + MO1-itgb2 control Fig. S6 with image from Xue et al., 2019
whole organism spi1b expression increased amount, abnormal TU + MO1-itgb2 control Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue coro1a expression increased amount, abnormal TU + MO1-itgb2 control Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue GFP expression increased amount, abnormal ioz1Tg; pku6Tg + MO1-itgb2 control Fig. 5 with image from Xue et al., 2019
caudal hematopoietic tissue hematopoietic cell increased amount, abnormal ioz1Tg; pku6Tg + MO1-itgb2 control Fig. 5 with image from Xue et al., 2019
caudal hematopoietic tissue GFP expression increased distribution, abnormal ioz1Tg; pku6Tg + MO1-itgb2 control Fig. 5 with image from Xue et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.