Morpholino

MO3-cldn5a

ID

ZDB-MRPHLNO-180212-4

Name

MO3-cldn5a

Previous Names

None

Target

Sequence

5' - GTACTAAAAGGAGTTTAGAAGTTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO, targets the 5' UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-cldn5a

Expressed Gene	Anatomy	Figures
cmlc1	heart tube	Fig. 2 from Kim et al., 2017
dand5	Kupffer's vesicle anatomical region	Fig. 3 from Kim et al., 2017
spaw	lateral plate mesoderm	Fig. 3 from Kim et al., 2017

Phenotype

Phenotype resulting from MO3-cldn5a

Phenotype	Fish	Figures
determination of heart left/right asymmetry disrupted, abnormal	TU + MO3-cldn5a	Fig. 2 , Fig. S4 from Kim et al., 2017
heart tube mislocalised, abnormal	TU + MO3-cldn5a	Fig. 2 , Fig. S4 from Kim et al., 2017
Kupffer's vesicle ab1-cldn5 labeling absent, abnormal	s870Tg + MO3-cldn5a	Fig. S2 from Kim et al., 2017
Kupffer's vesicle decreased area, abnormal	s870Tg + MO3-cldn5a	Fig. 5 , Fig. 6 from Kim et al., 2017
Kupffer's vesicle structure, cavities, abnormal	s870Tg + MO3-cldn5a	Fig. 5 from Kim et al., 2017
Kupffer's vesicle uninflated, abnormal	s870Tg + MO3-cldn5a	Fig. 5 from Kim et al., 2017
Kupffer's vesicle anatomical region dand5 expression spatial pattern, abnormal	TU + MO3-cldn5a	Fig. 3 from Kim et al., 2017
Kupffer's vesicle cell decreased amount, abnormal	s870Tg + MO3-cldn5a	Fig. S5 from Kim et al., 2017
Kupffer's vesicle cilium decreased amount, abnormal	s870Tg + MO3-cldn5a	Fig. 4 from Kim et al., 2017
left/right pattern formation disrupted, abnormal	TU + MO3-cldn5a	Fig. 3 from Kim et al., 2017

Phenotype of all Fish created by or utilizing MO3-cldn5a

Phenotype	Fish	Conditions	Figures
determination of heart left/right asymmetry disrupted, abnormal	TU + MO3-cldn5a	standard conditions	Fig. 2 , Fig. S4 from Kim et al., 2017
left/right pattern formation disrupted, abnormal	TU + MO3-cldn5a	standard conditions	Fig. 3 from Kim et al., 2017
Kupffer's vesicle anatomical region dand5 expression spatial pattern, abnormal	TU + MO3-cldn5a	standard conditions	Fig. 3 from Kim et al., 2017
heart tube mislocalised, abnormal	TU + MO3-cldn5a	standard conditions	Fig. 2 , Fig. S4 from Kim et al., 2017
Kupffer's vesicle structure, cavities, abnormal	s870Tg + MO3-cldn5a	standard conditions	Fig. 5 from Kim et al., 2017
Kupffer's vesicle decreased area, abnormal	s870Tg + MO3-cldn5a	standard conditions	Fig. 5 , Fig. 6 from Kim et al., 2017
Kupffer's vesicle cilium decreased amount, abnormal	s870Tg + MO3-cldn5a	standard conditions	Fig. 4 from Kim et al., 2017
Kupffer's vesicle ab1-cldn5 labeling absent, abnormal	s870Tg + MO3-cldn5a	standard conditions	Fig. S2 from Kim et al., 2017
Kupffer's vesicle decreased area, abnormal	s870Tg + MO3-cldn5a	chemical treatment: forskolin, chemical treatment: 3-isobutyl-1-methylxanthine	Fig. 6 from Kim et al., 2017
Kupffer's vesicle cell decreased amount, abnormal	s870Tg + MO3-cldn5a	standard conditions	Fig. S5 from Kim et al., 2017
Kupffer's vesicle uninflated, abnormal	s870Tg + MO3-cldn5a	standard conditions	Fig. 5 from Kim et al., 2017

Citations