Morpholino

MO2-rigi

ID
ZDB-MRPHLNO-180129-2
Name
MO2-rigi
Previous Names
  • MO2-ddx58
Target
Sequence
5' - GATTCTCCTTCTCCAGCTCGTACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rigi
Expressed Gene Anatomy Figures
gata1a Fig. 2 with image,  Fig. 3 with image from Wang et al., 2022
hey1 Fig. 7 with image from Wang et al., 2022
ifnphi1 Fig. 7 with image from Wang et al., 2022
ifnphi2 Fig. 7 with image from Wang et al., 2022
ifnphi3 Fig. 7 with image from Wang et al., 2022
ifnphi4 Fig. 7 with image from Wang et al., 2022
lcp1 Fig. 1 with image,  Fig. 3 with image from Wang et al., 2022
lmo2 Fig. 2 with image,  Fig. 4 with image from Wang et al., 2022
mpx Fig. 1 with image from Wang et al., 2022
spi1b Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Wang et al., 2022
stat1a Fig. 7 with image from Wang et al., 2022
stat1b Fig. 7 with image from Wang et al., 2022
tal1 Fig. 2 with image,  Fig. 4 with image,  Fig. 7 with image,  Fig. 8 with image from Wang et al., 2022
Phenotype
Phenotype resulting from MO2-rigi
Phenotype Fish Figures
anterior lateral mesoderm lmo2 expression decreased distribution, abnormal AB + MO2-rigi Fig. 2 with image,  Fig. 4 with image from Wang et al., 2022
anterior lateral mesoderm tal1 expression decreased distribution, abnormal AB + MO2-rigi Fig. 2 with image,  Fig. 4 with image,  Fig. 7 with image,  Fig. 8 with image from Wang et al., 2022
common myeloid progenitor decreased amount, abnormal AB + MO2-rigi Fig. 1 with image from Wang et al., 2022
common myeloid progenitor spi1b expression decreased distribution, abnormal AB + MO2-rigi Fig. 1 with image,  Fig. 3 with image from Wang et al., 2022
common myeloid progenitor decreased distribution, abnormal AB + MO2-rigi Fig. 1 with image from Wang et al., 2022
erythroid lineage cell gata1a expression decreased distribution, abnormal AB + MO2-rigi Fig. 2 with image,  Fig. 3 with image from Wang et al., 2022
granulocyte decreased amount, abnormal AB + MO2-rigi Fig. 1 with image from Wang et al., 2022
granulocyte mpx expression decreased distribution, abnormal AB + MO2-rigi Fig. 1 with image from Wang et al., 2022
granulocyte decreased distribution, abnormal AB + MO2-rigi Fig. 1 with image from Wang et al., 2022
macrophage decreased amount, abnormal AB + MO2-rigi Fig. 1 with image from Wang et al., 2022
macrophage lcp1 expression decreased distribution, abnormal AB + MO2-rigi Fig. 1 with image,  Fig. 3 with image from Wang et al., 2022
macrophage decreased distribution, abnormal AB + MO2-rigi Fig. 1 with image from Wang et al., 2022
nucleate erythrocyte decreased amount, abnormal AB + MO2-rigi Fig. 2 with image from Wang et al., 2022
nucleate erythrocyte decreased distribution, abnormal AB + MO2-rigi Fig. 2 with image from Wang et al., 2022
posterior lateral mesoderm tal1 expression decreased distribution, abnormal AB + MO2-rigi Fig. 2 with image,  Fig. 4 with image,  Fig. 7 with image,  Fig. 8 with image from Wang et al., 2022
posterior lateral mesoderm lmo2 expression decreased distribution, abnormal AB + MO2-rigi Fig. 2 with image,  Fig. 4 with image from Wang et al., 2022
whole organism gata1a expression decreased amount, abnormal AB + MO2-rigi Fig. 2 with image from Wang et al., 2022
whole organism spi1b expression decreased amount, abnormal AB + MO2-rigi Fig. 2 with image from Wang et al., 2022
whole organism tal1 expression decreased amount, abnormal AB + MO2-rigi Fig. 2 with image from Wang et al., 2022
whole organism lmo2 expression decreased amount, abnormal AB + MO2-rigi Fig. 2 with image from Wang et al., 2022
whole organism ifnphi3 expression decreased amount, abnormal AB + MO2-rigi Fig. 7 with image from Wang et al., 2022
whole organism ifnphi2 expression decreased amount, abnormal AB + MO2-rigi Fig. 7 with image from Wang et al., 2022
Phenotype of all Fish created by or utilizing MO2-rigi
Phenotype Fish Conditions Figures
posterior lateral mesoderm tal1 expression decreased distribution, abnormal AB + MO2-rigi control Fig. 2 with image,  Fig. 4 with image,  Fig. 7 with image,  Fig. 8 with image from Wang et al., 2022
whole organism tal1 expression decreased amount, abnormal AB + MO2-rigi control Fig. 2 with image from Wang et al., 2022
whole organism ifnphi2 expression decreased amount, abnormal AB + MO2-rigi control Fig. 7 with image from Wang et al., 2022
nucleate erythrocyte decreased distribution, abnormal AB + MO2-rigi control Fig. 2 with image from Wang et al., 2022
macrophage lcp1 expression decreased distribution, abnormal AB + MO2-rigi control Fig. 1 with image,  Fig. 3 with image from Wang et al., 2022
common myeloid progenitor spi1b expression decreased distribution, abnormal AB + MO2-rigi control Fig. 1 with image,  Fig. 3 with image from Wang et al., 2022
whole organism lmo2 expression decreased amount, abnormal AB + MO2-rigi control Fig. 2 with image from Wang et al., 2022
whole organism gata1a expression decreased amount, abnormal AB + MO2-rigi control Fig. 2 with image from Wang et al., 2022
whole organism spi1b expression decreased amount, abnormal AB + MO2-rigi control Fig. 2 with image from Wang et al., 2022
common myeloid progenitor decreased distribution, abnormal AB + MO2-rigi control Fig. 1 with image from Wang et al., 2022
common myeloid progenitor decreased amount, abnormal AB + MO2-rigi control Fig. 1 with image from Wang et al., 2022
posterior lateral mesoderm lmo2 expression decreased distribution, abnormal AB + MO2-rigi control Fig. 2 with image,  Fig. 4 with image from Wang et al., 2022
granulocyte decreased amount, abnormal AB + MO2-rigi control Fig. 1 with image from Wang et al., 2022
erythroid lineage cell gata1a expression decreased distribution, abnormal AB + MO2-rigi control Fig. 2 with image,  Fig. 3 with image from Wang et al., 2022
whole organism ifnphi3 expression decreased amount, abnormal AB + MO2-rigi control Fig. 7 with image from Wang et al., 2022
granulocyte mpx expression decreased distribution, abnormal AB + MO2-rigi control Fig. 1 with image from Wang et al., 2022
anterior lateral mesoderm tal1 expression decreased distribution, abnormal AB + MO2-rigi control Fig. 2 with image,  Fig. 4 with image,  Fig. 7 with image,  Fig. 8 with image from Wang et al., 2022
granulocyte decreased distribution, abnormal AB + MO2-rigi control Fig. 1 with image from Wang et al., 2022
macrophage decreased amount, abnormal AB + MO2-rigi control Fig. 1 with image from Wang et al., 2022
anterior lateral mesoderm lmo2 expression decreased distribution, abnormal AB + MO2-rigi control Fig. 2 with image,  Fig. 4 with image from Wang et al., 2022
macrophage decreased distribution, abnormal AB + MO2-rigi control Fig. 1 with image from Wang et al., 2022
nucleate erythrocyte decreased amount, abnormal AB + MO2-rigi control Fig. 2 with image from Wang et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.