Morpholino

MO3-ccn2a

ID
ZDB-MRPHLNO-150126-6
Name
MO3-ccn2a
Previous Names
  • MO3-ctgfa
Target
Sequence
5' - GAGTCATTCCAGAAAACATGATGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ccn2a
Phenotype
Phenotype resulting from MO3-ccn2a
Phenotype Fish Figures
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO3-ccn2a Fig. 3 with imageFig. 4 with image from Fukui et al., 2014
caudal hematopoietic tissue mfap4.1 expression increased amount, abnormal TU + MO3-ccn2a Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue myb expression increased amount, abnormal TU + MO3-ccn2a Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue coro1a expression increased amount, abnormal TU + MO3-ccn2a Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue gata1a expression increased amount, abnormal TU + MO3-ccn2a Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue GFP expression increased amount, abnormal ioz1Tg; pku6Tg + MO3-ccn2a Fig. 5 with image from Xue et al., 2019
caudal hematopoietic tissue GFP expression increased distribution, abnormal ioz1Tg; pku6Tg + MO3-ccn2a Fig. 5 with image from Xue et al., 2019
caudal hematopoietic tissue hematopoietic cell increased amount, abnormal ioz1Tg; pku6Tg + MO3-ccn2a Fig. 5 with image from Xue et al., 2019
endoderm anterior region apoptotic, abnormal ha01Tg + MO3-ccn2a Fig. 3 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO3-ccn2a Fig. 4 with image from Fukui et al., 2014
endoderm apoptotic process increased occurrence, abnormal ha01Tg + MO3-ccn2a Fig. 3 with image from Fukui et al., 2014
heart split bilaterally, abnormal ha01Tg; ncv11Tg + MO3-ccn2a Fig. 4 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO3-ccn2a Fig. 3 with imageFig. 4 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg + MO3-ccn2a Fig. 3 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO3-ccn2a Fig. 4 with image from Fukui et al., 2014
whole organism spi1b expression increased amount, abnormal TU + MO3-ccn2a Fig. S6 with image from Xue et al., 2019
whole organism myb expression increased amount, abnormal TU + MO3-ccn2a Fig. S6 with image from Xue et al., 2019
whole organism gata1a expression increased amount, abnormal TU + MO3-ccn2a Fig. S6 with image from Xue et al., 2019
Phenotype of all Fish created by or utilizing MO3-ccn2a
Phenotype Fish Conditions Figures
caudal hematopoietic tissue coro1a expression increased amount, abnormal TU + MO3-ccn2a control Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue mfap4.1 expression increased amount, abnormal TU + MO3-ccn2a control Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue gata1a expression increased amount, abnormal TU + MO3-ccn2a control Fig. S6 with image from Xue et al., 2019
whole organism gata1a expression increased amount, abnormal TU + MO3-ccn2a control Fig. S6 with image from Xue et al., 2019
whole organism myb expression increased amount, abnormal TU + MO3-ccn2a control Fig. S6 with image from Xue et al., 2019
whole organism spi1b expression increased amount, abnormal TU + MO3-ccn2a control Fig. S6 with image from Xue et al., 2019
caudal hematopoietic tissue myb expression increased amount, abnormal TU + MO3-ccn2a control Fig. S6 with image from Xue et al., 2019
heart tube split bilaterally, abnormal ha01Tg + MO3-ccn2a standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm apoptotic process increased occurrence, abnormal ha01Tg + MO3-ccn2a standard conditions Fig. 3 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg + MO3-ccn2a standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm anterior region apoptotic, abnormal ha01Tg + MO3-ccn2a standard conditions Fig. 3 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg + MO3-ccn2a standard conditions Fig. 3 with image from Fukui et al., 2014
heart split bilaterally, abnormal ha01Tg; ncv11Tg + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
caudal hematopoietic tissue GFP expression increased distribution, abnormal ioz1Tg; pku6Tg + MO3-ccn2a control Fig. 5 with image from Xue et al., 2019
caudal hematopoietic tissue hematopoietic cell increased amount, abnormal ioz1Tg; pku6Tg + MO3-ccn2a control Fig. 5 with image from Xue et al., 2019
caudal hematopoietic tissue GFP expression increased amount, abnormal ioz1Tg; pku6Tg + MO3-ccn2a control Fig. 5 with image from Xue et al., 2019
caudal hematopoietic tissue myb expression amount, ameliorated pd97Tg + MO3-ccn2a heat shock Fig. S6 with image from Xue et al., 2019
heart split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
Citations