Morpholino

MO6-sox2

ID

ZDB-MRPHLNO-140611-1

Name

MO6-sox2

Previous Names

Target

Sequence

5' - TCTTGAAAGTCTACCCCACCAGCCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO6-sox2

Expressed Gene	Anatomy	Figures
gfi1ab	parapineal organ	Fig. 7 from Pavlou et al., 2014
kctd12.1	habenula	Fig. 7 from Pavlou et al., 2014
noto	neural plate presumptive diencephalon	Fig. 3 from Pavlou et al., 2014

Phenotype

Phenotype resulting from MO6-sox2

Phenotype	Fish	Figures
determination of left/right asymmetry in diencephalon process quality, abnormal	WT + MO6-sox2	Fig. 7 from Pavlou et al., 2014
eye decreased size, abnormal	WT + MO6-sox2	Fig. 1 from Pavlou et al., 2014
habenula development process quality, abnormal	WT + MO6-sox2	Fig. 7 from Pavlou et al., 2014
parapineal organ determination of left/right asymmetry in diencephalon process quality, abnormal	WT + MO6-sox2	Fig. 7 from Pavlou et al., 2014
parapineal organ epithalamus development process quality, abnormal	WT + MO6-sox2	Fig. 7 from Pavlou et al., 2014
pineal complex photoreceptor cell increased amount, abnormal	y8Tg + MO6-sox2	Fig. 4 , Fig. 5 , Fig. 6 , Fig. S9 from Pavlou et al., 2014
whole organism decreased length, abnormal	WT + MO6-sox2	Fig. 1 from Pavlou et al., 2014

Phenotype of all Fish created by or utilizing MO6-sox2

Phenotype	Fish	Conditions	Figures
parapineal organ determination of left/right asymmetry in diencephalon process quality, abnormal	WT + MO6-sox2	standard conditions	Fig. 7 from Pavlou et al., 2014
determination of left/right asymmetry in diencephalon process quality, abnormal	WT + MO6-sox2	standard conditions	Fig. 7 from Pavlou et al., 2014
whole organism decreased length, abnormal	WT + MO6-sox2	standard conditions	Fig. 1 from Pavlou et al., 2014
parapineal organ epithalamus development process quality, abnormal	WT + MO6-sox2	standard conditions	Fig. 7 from Pavlou et al., 2014
habenula development process quality, abnormal	WT + MO6-sox2	standard conditions	Fig. 7 from Pavlou et al., 2014
eye decreased size, abnormal	WT + MO6-sox2	standard conditions	Fig. 1 from Pavlou et al., 2014
pineal complex photoreceptor cell increased amount, abnormal	y8Tg + MO6-sox2	standard conditions	Fig. 4 , Fig. 5 , Fig. 6 , Fig. S9 from Pavlou et al., 2014
pineal complex photoreceptor cell increased amount, abnormal	y8Tg + MO6-sox2	chemical treatment: DAPT	Fig. 5 from Pavlou et al., 2014

Citations