Morpholino

MO4-sbds

ID
ZDB-MRPHLNO-120820-2
Name
MO4-sbds
Previous Names
  • Sbds ATG MO (1)
Target
Sequence
5' - TTAGTTGGCGTGAATATTGACATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-sbds
Phenotype
Phenotype resulting from MO4-sbds
Phenotype Fish Figures
anterior lateral mesoderm neutrophil absent, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
ceratobranchial cartilage morphology, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
ceratohyal cartilage morphology, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
endocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 Fig. 2 with imageFig. 3 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 Fig. 3 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 Fig. 3 with image from Provost et al., 2012
intermediate cell mass of mesoderm neutrophil absent, abnormal WT + MO4-sbds Fig. 2 with imageFig. 3 with image from Provost et al., 2012
neutrophil aggregation disrupted, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
opercle decreased thickness, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
opercle shape, abnormal WT + MO4-sbds Fig. 2 with image from Provost et al., 2012
pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds Fig. 2 with image from Provost et al., 2012
post-vent region curved, abnormal jh1Tg; jh2Tg + MO4-sbds Fig. 3 with image from Provost et al., 2012
whole organism dead, abnormal WT + MO4-sbds Fig. 1 with image from Provost et al., 2012
whole organism cytosolic ribosome assembly disrupted, abnormal WT + MO4-sbds Fig. 1 with image from Provost et al., 2012
whole organism cytosolic small ribosomal subunit decreased amount, abnormal WT + MO4-sbds Fig. 1 with image from Provost et al., 2012
Phenotype of all Fish created by or utilizing MO4-sbds
Phenotype Fish Conditions Figures
intermediate cell mass of mesoderm neutrophil absent, abnormal WT + MO4-sbds standard conditions Fig. 2 with imageFig. 3 with image from Provost et al., 2012
whole organism cytosolic ribosome assembly disrupted, abnormal WT + MO4-sbds standard conditions Fig. 1 with image from Provost et al., 2012
whole organism cytosolic small ribosomal subunit decreased amount, abnormal WT + MO4-sbds standard conditions Fig. 1 with image from Provost et al., 2012
opercle shape, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
opercle decreased thickness, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
neutrophil aggregation disrupted, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
whole organism dead, abnormal WT + MO4-sbds standard conditions Fig. 1 with image from Provost et al., 2012
ceratohyal cartilage morphology, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
anterior lateral mesoderm neutrophil absent, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
ceratobranchial cartilage morphology, abnormal WT + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
post-vent region curved, abnormal WT + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
intermediate cell mass of mesoderm neutrophil absent, abnormal WT + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO3-tp53 + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal jh1Tg; jh2Tg + MO3-tp53 + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
endocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO3-tp53 + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 2 with image from Provost et al., 2012
post-vent region curved, abnormal jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
endocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 2 with imageFig. 3 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 3 with image from Provost et al., 2012
endocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal jh1Tg; jh2Tg + MO4-sbds + MO4-tp53 standard conditions Fig. 3 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal tp53zdf1/zdf1 + MO4-sbds standard conditions Fig. 7 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal tp53zdf1/zdf1 + MO4-sbds standard conditions Fig. 7 with image from Provost et al., 2012
exocrine pancreas development disrupted, abnormal tp53zdf1/zdf1; jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 5 with image from Provost et al., 2012
exocrine pancreas decreased size, abnormal tp53zdf1/zdf1; jh1Tg; jh2Tg + MO4-sbds standard conditions Fig. 5 with image from Provost et al., 2012
Citations