Morpholino

MO1-lzts2a

ID
ZDB-MRPHLNO-120125-5
Name
MO1-lzts2a
Previous Names
None
Target
Sequence
5' - CATGGTGAACACCCGACCAGGACAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lzts2a
Expressed Gene Anatomy Figures
bmp4 Fig. 5 from Li et al., 2011
chrd Fig. 4 from Li et al., 2011
cp Fig. 5 from Li et al., 2011
ctslb Fig. 4 from Li et al., 2011
dlx3b Fig. 4 from Li et al., 2011
foxd3 Fig. 4 from Li et al., 2011
gcga Fig. 5 from Li et al., 2011
ins Fig. 5 from Li et al., 2011
myl7 Fig. 5 from Li et al., 2011
myod1 Fig. 4 from Li et al., 2011
pcdh8 Fig. 4 from Li et al., 2011
pdx1 Fig. 5 from Li et al., 2011
shha Fig. 4 from Li et al., 2011
sox17 Fig. 4 from Li et al., 2011
sst Fig. 5 from Li et al., 2011
tbxta Fig. 4 from Li et al., 2011
Phenotype
Phenotype resulting from MO1-lzts2a
Phenotype Fish Figures
axis anterior-posterior axis elongated, abnormal WT + MO1-lzts2a Fig. 2 from Li et al., 2011
axis anterior-posterior axis shortened, abnormal WT + MO1-lzts2a Fig. 2 from Li et al., 2011
caudal fin kinked, abnormal WT + MO1-lzts2a Fig. 2 from Li et al., 2011
caudal fin shortened, abnormal WT + MO1-lzts2a Fig. 2 from Li et al., 2011
convergent extension disrupted, abnormal WT + MO1-lzts2a Fig. 3 from Li et al., 2011
dorsal convergence decreased duration, abnormal WT + MO1-lzts2a Fig. 3 from Li et al., 2011
eye decreased size, abnormal WT + MO1-lzts2a Fig. 2 from Li et al., 2011
head decreased size, abnormal WT + MO1-lzts2a Fig. 2 from Li et al., 2011
mediolateral intercalation disrupted, abnormal WT + MO1-lzts2a Fig. 3 from Li et al., 2011
shield increased thickness, abnormal WT + MO1-lzts2a Fig. 2 from Li et al., 2011
Phenotype of all Fish created by or utilizing MO1-lzts2a
Phenotype Fish Conditions Figures
eye decreased size, abnormal WT + MO1-lzts2a standard conditions Fig. 2 from Li et al., 2011
convergent extension disrupted, abnormal WT + MO1-lzts2a standard conditions Fig. 3 from Li et al., 2011
mediolateral intercalation disrupted, abnormal WT + MO1-lzts2a standard conditions Fig. 3 from Li et al., 2011
head decreased size, abnormal WT + MO1-lzts2a standard conditions Fig. 2 from Li et al., 2011
axis anterior-posterior axis shortened, abnormal WT + MO1-lzts2a standard conditions Fig. 2 from Li et al., 2011
dorsal convergence decreased duration, abnormal WT + MO1-lzts2a standard conditions Fig. 3 from Li et al., 2011
caudal fin kinked, abnormal WT + MO1-lzts2a standard conditions Fig. 2 from Li et al., 2011
shield increased thickness, abnormal WT + MO1-lzts2a standard conditions Fig. 2 from Li et al., 2011
caudal fin shortened, abnormal WT + MO1-lzts2a standard conditions Fig. 2 from Li et al., 2011
axis anterior-posterior axis elongated, abnormal WT + MO1-lzts2a standard conditions Fig. 2 from Li et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.