Morpholino

MO9-runx1

ID

ZDB-MRPHLNO-100813-4

Name

MO9-runx1

Previous Names

runx1 runt domain MO (1)

Target

runx1 (1)

Sequence

5' - TTTTCAGCATCTCACCTCGTCCGCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO9-runx1

Expressed Gene	Anatomy	Figures
gata1a	intermediate cell mass of mesoderm	Fig. 3 from Lam et al., 2009
hhex	intermediate cell mass of mesoderm	Fig. 3 from Lam et al., 2009
mpx	intermediate cell mass of mesoderm	Fig. 3 from Lam et al., 2009
myb	intermediate cell mass of mesoderm	Fig. 3 from Lam et al., 2009
runx1	intermediate cell mass of mesoderm	Fig. 3 from Lam et al., 2009
spi1b	intermediate cell mass of mesoderm	Fig. 3 from Lam et al., 2009
tal1	intermediate cell mass of mesoderm	Fig. 3 from Lam et al., 2009

Phenotype

Phenotype resulting from MO9-runx1

Phenotype	Fish	Figures
granulocyte differentiation decreased occurrence, abnormal	nz50Tg; zf188Tg + MO9-runx1	Fig. 2 from Hall et al., 2012
granulocyte differentiation decreased rate, abnormal	WT + MO9-runx1	Fig. S2 from Hall et al., 2012
hematopoietic stem cell aplastic, abnormal	zf188Tg + MO9-runx1	Fig. S2 from Hall et al., 2012
hemopoiesis disrupted, abnormal	zf188Tg + MO9-runx1	Fig. 5 from Lam et al., 2009
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal	nz50Tg; zf188Tg + MO9-runx1	Fig. 2 from Hall et al., 2012
ventral wall of dorsal aorta neutrophil decreased amount, abnormal	nz50Tg; zf188Tg + MO9-runx1	Fig. 2 from Hall et al., 2012

Phenotype of all Fish created by or utilizing MO9-runx1

Phenotype	Fish	Conditions	Figures
granulocyte differentiation decreased rate, abnormal	WT + MO9-runx1	standard conditions	Fig. S2 from Hall et al., 2012
whole organism decreased life span, abnormal	WT + MO9-runx1	bacterial treatment: Salmonella enterica subsp. enterica serovar Typhimurium	Fig. S2 from Hall et al., 2012
hematopoietic stem cell aplastic, abnormal	zf188Tg + MO9-runx1	standard conditions	Fig. S2 from Hall et al., 2012
hemopoiesis disrupted, abnormal	zf188Tg + MO9-runx1	standard conditions	Fig. 5 from Lam et al., 2009
ventral wall of dorsal aorta neutrophil decreased amount, abnormal	nz50Tg; zf188Tg + MO9-runx1	standard conditions	Fig. 2 from Hall et al., 2012
granulocyte differentiation decreased occurrence, abnormal	nz50Tg; zf188Tg + MO9-runx1	bacterial treatment: Salmonella enterica subsp. enterica serovar Typhimurium	Fig. 2 from Hall et al., 2012
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal	nz50Tg; zf188Tg + MO9-runx1	bacterial treatment: Salmonella enterica subsp. enterica serovar Typhimurium	Fig. 2 from Hall et al., 2012
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal	nz50Tg; zf188Tg + MO9-runx1	standard conditions	Fig. 2 from Hall et al., 2012
ventral wall of dorsal aorta neutrophil decreased amount, abnormal	nz50Tg; zf188Tg + MO9-runx1	bacterial treatment: Salmonella enterica subsp. enterica serovar Typhimurium	Fig. 2 from Hall et al., 2012
granulocyte differentiation decreased occurrence, abnormal	nz50Tg; zf188Tg + MO9-runx1	standard conditions	Fig. 2 from Hall et al., 2012

Citations