Morpholino

MO3-fgf4

ID
ZDB-MRPHLNO-100511-1
Name
MO3-fgf4
Previous Names
  • fgf4 MO1 (1)
Target
Sequence
5' - TTTCATACTCACAGATCCGTAAAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fgf4
Expressed Gene Anatomy Figures
cp Fig. 2 with image from Yamauchi et al., 2009
fgf8a Fig. 6 with image from Yamauchi et al., 2009
foxa3 Fig. 2 with image from Yamauchi et al., 2009
lft1 Fig. 5 with image from Yamauchi et al., 2009
lft2 Fig. 5 with image from Yamauchi et al., 2009
myl7 Fig. 2 with image from Yamauchi et al., 2009
pdx1 Fig. 2 with image from Yamauchi et al., 2009
pitx2 Fig. 5 with image from Yamauchi et al., 2009
spaw Fig. 5 with image from Yamauchi et al., 2009
Phenotype
Phenotype resulting from MO3-fgf4
Phenotype Fish Figures
brain decreased size, abnormal WT + MO3-fgf4 Fig. 1 with image from Yamauchi et al., 2009
determination of heart left/right asymmetry disrupted, abnormal WT + MO3-fgf4 Fig. 2 with image,  Fig. 5 with image from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal WT + MO3-fgf4 Fig. 2 with image from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO3-fgf4 Fig. 2 with image from Yamauchi et al., 2009
heart mislocalised, abnormal WT + MO3-fgf4 Fig. 2 with image from Yamauchi et al., 2009
heart development disrupted, abnormal WT + MO3-fgf4 Fig. 5 with image from Yamauchi et al., 2009
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO3-fgf4 Fig. 4 with image from Yamauchi et al., 2009
liver mislocalised, abnormal WT + MO3-fgf4 Fig. 2 with image from Yamauchi et al., 2009
pancreas mislocalised, abnormal WT + MO3-fgf4 Fig. 2 with image from Yamauchi et al., 2009
pericardium edematous, abnormal WT + MO3-fgf4 Fig. 1 with image from Yamauchi et al., 2009
trunk bent, abnormal WT + MO3-fgf4 Fig. 1 with image from Yamauchi et al., 2009
Phenotype of all Fish created by or utilizing MO3-fgf4
Phenotype Fish Conditions Figures
heart mislocalised, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
pancreas mislocalised, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
trunk bent, abnormal WT + MO3-fgf4 standard conditions Fig. 1 with image from Yamauchi et al., 2009
brain decreased size, abnormal WT + MO3-fgf4 standard conditions Fig. 1 with image from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO3-fgf4 standard conditions Fig. 4 with image from Yamauchi et al., 2009
determination of heart left/right asymmetry disrupted, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with image,  Fig. 5 with image from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
pericardium edematous, abnormal WT + MO3-fgf4 standard conditions Fig. 1 with image from Yamauchi et al., 2009
heart development disrupted, abnormal WT + MO3-fgf4 standard conditions Fig. 5 with image from Yamauchi et al., 2009
liver mislocalised, abnormal WT + MO3-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
pancreas mislocalised, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
liver mislocalised, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.