Morpholino

MO2-nme2b.1

ID
ZDB-MRPHLNO-091119-1
Name
MO2-nme2b.1
Previous Names
  • MO2-nme2
Target
Sequence
5' - GGTGCGCTCGGTCTTAGCAGACATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nme2b.1
Expressed Gene Anatomy Figures
cav1 Fig. 5 with image from Hippe et al., 2009
cav3 Fig. 5 with image from Hippe et al., 2009
gnai2b Fig. 5 with image from Hippe et al., 2009
gnai3 Fig. 5 with image from Hippe et al., 2009
gnas Fig. 5 with image from Hippe et al., 2009
gnb1a Fig. 1 with image,  Fig. 5 with image from Hippe et al., 2009
gng2 Fig. 1 with image from Hippe et al., 2009
myh6 Fig. 2 with image from Hippe et al., 2009
nme2b.1 Fig. 1 with image,  Fig. 5 with image from Hippe et al., 2009
Phenotype
Phenotype resulting from MO2-nme2b.1
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO2-nme2b.1 Fig. S1 from Feng et al., 2014
brain vasculature malformed, abnormal y1Tg + MO2-nme2b.1 Fig. S1 from Feng et al., 2014
cAMP biosynthetic process decreased rate, abnormal f1Tg + MO2-nme2b.1 Fig. 5 with image from Hippe et al., 2009
central artery malformed, abnormal y1Tg + MO2-nme2b.1 Fig. S1 from Feng et al., 2014
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO2-nme2b.1 Fig. 1 from Feng et al., 2014
eye decreased size, abnormal WT + MO2-nme2b.1 Fig. 2 with image from Hippe et al., 2009
GTP biosynthetic process decreased rate, abnormal WT + MO2-nme2b.1 Fig. 1 with image from Hippe et al., 2009
heart composition, abnormal f1Tg + MO2-nme2b.1 Fig. 5 with image from Hippe et al., 2009
heart decreased contractility, abnormal WT + MO2-nme2b.1 Fig. 2 with image from Hippe et al., 2009
heart decreased functionality, abnormal WT + MO2-nme2b.1 Fig. 2 with image from Hippe et al., 2009
heart contraction decreased rate, abnormal WT + MO2-nme2b.1 Fig. 2 with image from Hippe et al., 2009
heart contraction process quality, abnormal WT + MO2-nme2b.1 Fig. 1 from Hippe et al., 2011
intersegmental vessel malformed, abnormal y1Tg + MO2-nme2b.1 Fig. 1 from Feng et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO2-nme2b.1 Fig. 1 from Feng et al., 2014
pericardium edematous, abnormal WT + MO2-nme2b.1 Fig. 1 from Hippe et al., 2011
Fig. 2 with image from Hippe et al., 2009
subintestinal vein absent, abnormal y1Tg + MO2-nme2b.1 Fig. 1 from Feng et al., 2014
subintestinal vein malformed, abnormal y1Tg + MO2-nme2b.1 Fig. 1 from Feng et al., 2014
whole organism ab1-gnb labeling decreased amount, abnormal WT + MO2-nme2b.1 Fig. 1 from Hippe et al., 2011
Phenotype of all Fish created by or utilizing MO2-nme2b.1
Phenotype Fish Conditions Figures
whole organism ab1-gnb labeling decreased amount, abnormal WT + MO2-nme2b.1 control Fig. 1 from Hippe et al., 2011
heart decreased contractility, abnormal WT + MO2-nme2b.1 standard conditions Fig. 2 with image from Hippe et al., 2009
pericardium edematous, abnormal WT + MO2-nme2b.1 standard conditions Fig. 1 from Hippe et al., 2011
Fig. 2 with image from Hippe et al., 2009
heart contraction decreased rate, abnormal WT + MO2-nme2b.1 standard conditions Fig. 2 with image from Hippe et al., 2009
heart contraction process quality, abnormal WT + MO2-nme2b.1 control Fig. 1 from Hippe et al., 2011
heart decreased functionality, abnormal WT + MO2-nme2b.1 standard conditions Fig. 2 with image from Hippe et al., 2009
eye decreased size, abnormal WT + MO2-nme2b.1 standard conditions Fig. 2 with image from Hippe et al., 2009
GTP biosynthetic process decreased rate, abnormal WT + MO2-nme2b.1 standard conditions Fig. 1 with image from Hippe et al., 2009
heart composition, abnormal f1Tg + MO2-nme2b.1 standard conditions Fig. 5 with image from Hippe et al., 2009
cAMP biosynthetic process decreased rate, abnormal f1Tg + MO2-nme2b.1 standard conditions Fig. 5 with image from Hippe et al., 2009
subintestinal vein absent, abnormal y1Tg + MO2-nme2b.1 standard conditions Fig. 1 from Feng et al., 2014
subintestinal vein malformed, abnormal y1Tg + MO2-nme2b.1 standard conditions Fig. 1 from Feng et al., 2014
central artery malformed, abnormal y1Tg + MO2-nme2b.1 standard conditions Fig. S1 from Feng et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO2-nme2b.1 standard conditions Fig. 1 from Feng et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO2-nme2b.1 standard conditions Fig. 1 from Feng et al., 2014
brain vasculature malformed, abnormal y1Tg + MO2-nme2b.1 standard conditions Fig. S1 from Feng et al., 2014
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO2-nme2b.1 standard conditions Fig. 1 from Feng et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO2-nme2b.1 standard conditions Fig. S1 from Feng et al., 2014
cardiac ventricle heart contraction process quality, abnormal WT + MO1-nme3 + MO2-nme2b.1 standard conditions Fig. 6 from Abu-Taha et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.