Morpholino

MO2-osr1

ID
ZDB-MRPHLNO-090121-1
Name
MO2-osr1
Previous Names
  • osr1 ex2d (1)
Target
Sequence
5' - ATCTCATCCTTACCTGTGGTCTCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the splice donor site of exon 2.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-osr1
Expressed Gene Anatomy Figures
etsrp Fig. 5 with image from Mudumana et al., 2008
foxa2 Fig. 7 with image from Terashima et al., 2014
Fig. 10 with image from Mudumana et al., 2008
gata1a Fig. 5 with image from Mudumana et al., 2008
kdrl Fig. 5 with image from Mudumana et al., 2008
lhx1a Fig. 5 from Tomar et al., 2014
myod1 Fig. S4 with image from Mudumana et al., 2008
nphs1 Figure 5 with image from Drummond et al., 2022
Fig. 4,  Fig. 5 from Tomar et al., 2014
Fig. 3 with image,  Fig. 4 with image from Mudumana et al., 2008
nphs2 Fig. 4 from Tomar et al., 2014
osr1 Fig. 3 with image from Mudumana et al., 2008
pax2a Fig. 5 with image,  Fig. 9 with image,  Fig. 11 with image,  Fig. S4 with image,  Fig. S5 with image from Mudumana et al., 2008
ret Fig. S2 with image from Mudumana et al., 2008
slc4a2a Fig. 4 from Tomar et al., 2014
Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image from Mudumana et al., 2008
sox17 Fig. 7 with image from Terashima et al., 2014
Fig. 10 with image from Mudumana et al., 2008
sox32 Fig. 6 with image from Terashima et al., 2014
spi1b Fig. 5 with image from Mudumana et al., 2008
tal1 Fig. 5 with image,  Fig. 8 with image,  Fig. 9 with image,  Fig. S4 with image from Mudumana et al., 2008
trpm7 Fig. S2 with image from Mudumana et al., 2008
wt1a Fig. 4 from Tomar et al., 2014
Fig. 4 with image from Mudumana et al., 2008
wt1b Figure 5 with image from Drummond et al., 2022
Phenotype
Phenotype resulting from MO2-osr1
Phenotype Fish Figures
anterior lateral mesoderm morphology, abnormal AB/TU + MO2-osr1 Fig. 8 with image from Mudumana et al., 2008
anterior lateral plate mesoderm morphology, abnormal AB/TU + MO2-osr1 Fig. 9 with image from Mudumana et al., 2008
caudal vein plexus dilated, abnormal AB/TU + MO2-osr1 Fig. 7 with image from Mudumana et al., 2008
common cardinal vein increased diameter, abnormal AB/TU + MO2-osr1 Fig. 7 with image from Mudumana et al., 2008
endoderm development disrupted, abnormal AB/TU + MO2-osr1 Fig. 10 with image from Mudumana et al., 2008
endodermal cell differentiation increased occurrence, abnormal AB/TU + MO2-osr1 Fig. 6 with image,  Fig. 7 with image from Terashima et al., 2014
hemangioblast cell differentiation disrupted, abnormal AB/TU + MO2-osr1 Fig. 5 with image from Mudumana et al., 2008
hypoblast has extra parts of type endodermal cell, abnormal AB/TU + MO2-osr1 Fig. 6 with image,  Fig. 7 with image from Terashima et al., 2014
intermediate mesoderm morphology, abnormal AB/TU + MO2-osr1 Fig. 9 with image from Mudumana et al., 2008
intermediate mesoderm anterior region lhx1a expression absent, abnormal AB/TU + MO2-osr1 Fig. 5 from Tomar et al., 2014
intermediate mesoderm apoptotic process increased process quality, abnormal WT + MO2-osr1 Figure 2 with image from Drummond et al., 2022
intermediate mesodermal cell differentiation disrupted, abnormal AB/TU + MO2-osr1 Fig. S4 with image from Mudumana et al., 2008
lateral mesodermal cell differentiation disrupted, abnormal AB/TU + MO2-osr1 Fig. S4 with image from Mudumana et al., 2008
pectoral fin decreased size, abnormal WT + MO2-osr1 Table 1 from Neto et al., 2012
pectoral fin development disrupted, abnormal WT + MO2-osr1 Table 1 from Neto et al., 2012
pharyngeal endoderm increased width, abnormal AB/TU + MO2-osr1 Fig. 10 with image from Mudumana et al., 2008
podocyte differentiation disrupted, abnormal AB/TU + MO2-osr1 Fig. 5 from Tomar et al., 2014
presumptive endoderm increased width, abnormal AB/TU + MO2-osr1 Fig. 10 with image from Mudumana et al., 2008
pronephric duct anterior region slc4a2a expression absent, abnormal AB/TU + MO2-osr1 Fig. 4 from Tomar et al., 2014
pronephric glomerulus aplastic, abnormal AB/TU + MO2-osr1 Fig. 4 with image,  Fig. 7 with image from Mudumana et al., 2008
pronephric glomerulus slit diaphragm nphs1 expression absent, abnormal WT + MO2-osr1 Figure 5 with image from Drummond et al., 2022
pronephric glomerulus morphogenesis disrupted, abnormal AB/TU + MO2-osr1 Fig. 4 from Tomar et al., 2014
pronephric podocyte absence of anatomical entity, abnormal WT + MO2-osr1 Figure 5 with image from Drummond et al., 2022
pronephric podocyte nphs2 expression absent, abnormal AB/TU + MO2-osr1 Fig. 4 from Tomar et al., 2014
pronephric podocyte nphs1 expression absent, abnormal AB/TU + MO2-osr1 Fig. 4,  Fig. 5 from Tomar et al., 2014
pronephric podocyte wt1b expression absent, abnormal WT + MO2-osr1 Figure 5 with image from Drummond et al., 2022
pronephric podocyte mislocalised, abnormal AB/TU + MO2-osr1 Fig. 4 from Tomar et al., 2014
pronephric podocyte morphology, abnormal AB/TU + MO2-osr1 Fig. 4 with image from Mudumana et al., 2008
pronephric podocyte apoptotic process increased process quality, abnormal WT + MO2-osr1 Figure 2 with image from Drummond et al., 2022
pronephric proximal convoluted tubule morphology, abnormal AB/TU + MO2-osr1 Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image from Mudumana et al., 2008
pronephric proximal tubule development disrupted, abnormal AB/TU + MO2-osr1 Fig. 4 from Tomar et al., 2014
pronephric tubule aplastic, abnormal AB/TU + MO2-osr1 Fig. 3 with image,  Fig. 7 with image from Mudumana et al., 2008
pronephric tubule decreased diameter, abnormal AB/TU + MO2-osr1 Fig. 7 with image from Mudumana et al., 2008
pronephric tubule morphology, abnormal AB/TU + MO2-osr1 Fig. 3 with image,  Fig. 11 with image from Mudumana et al., 2008
pronephros morphology, abnormal AB/TU + MO2-osr1 Fig. S4 with image from Mudumana et al., 2008
pronephros development disrupted, abnormal AB/TU + MO2-osr1 Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image,  Fig. 11 with image from Mudumana et al., 2008
Phenotype of all Fish created by or utilizing MO2-osr1
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule morphology, abnormal AB/TU + MO2-osr1 standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image from Mudumana et al., 2008
intermediate mesodermal cell differentiation disrupted, abnormal AB/TU + MO2-osr1 standard conditions Fig. S4 with image from Mudumana et al., 2008
podocyte differentiation disrupted, abnormal AB/TU + MO2-osr1 standard conditions Fig. 5 from Tomar et al., 2014
presumptive endoderm increased width, abnormal AB/TU + MO2-osr1 standard conditions Fig. 10 with image from Mudumana et al., 2008
anterior lateral mesoderm morphology, abnormal AB/TU + MO2-osr1 standard conditions Fig. 8 with image from Mudumana et al., 2008
common cardinal vein increased diameter, abnormal AB/TU + MO2-osr1 standard conditions Fig. 7 with image from Mudumana et al., 2008
pronephric tubule morphology, abnormal AB/TU + MO2-osr1 standard conditions Fig. 3 with image,  Fig. 11 with image from Mudumana et al., 2008
pronephric podocyte nphs2 expression absent, abnormal AB/TU + MO2-osr1 standard conditions Fig. 4 from Tomar et al., 2014
pharyngeal endoderm increased width, abnormal AB/TU + MO2-osr1 standard conditions Fig. 10 with image from Mudumana et al., 2008
lateral mesodermal cell differentiation disrupted, abnormal AB/TU + MO2-osr1 standard conditions Fig. S4 with image from Mudumana et al., 2008
pronephric glomerulus morphogenesis disrupted, abnormal AB/TU + MO2-osr1 standard conditions Fig. 4 from Tomar et al., 2014
intermediate mesoderm anterior region lhx1a expression absent, abnormal AB/TU + MO2-osr1 standard conditions Fig. 5 from Tomar et al., 2014
pronephric podocyte nphs1 expression absent, abnormal AB/TU + MO2-osr1 standard conditions Fig. 4,  Fig. 5 from Tomar et al., 2014
pronephros morphology, abnormal AB/TU + MO2-osr1 standard conditions Fig. S4 with image from Mudumana et al., 2008
hypoblast has extra parts of type endodermal cell, abnormal AB/TU + MO2-osr1 standard conditions Fig. 6 with image,  Fig. 7 with image from Terashima et al., 2014
pronephric proximal tubule development disrupted, abnormal AB/TU + MO2-osr1 standard conditions Fig. 4 from Tomar et al., 2014
endodermal cell differentiation increased occurrence, abnormal AB/TU + MO2-osr1 standard conditions Fig. 6 with image,  Fig. 7 with image from Terashima et al., 2014
pronephric tubule decreased diameter, abnormal AB/TU + MO2-osr1 standard conditions Fig. 7 with image from Mudumana et al., 2008
pronephric tubule aplastic, abnormal AB/TU + MO2-osr1 standard conditions Fig. 3 with image,  Fig. 7 with image from Mudumana et al., 2008
intermediate mesoderm morphology, abnormal AB/TU + MO2-osr1 standard conditions Fig. 9 with image from Mudumana et al., 2008
anterior lateral plate mesoderm morphology, abnormal AB/TU + MO2-osr1 standard conditions Fig. 9 with image from Mudumana et al., 2008
pronephric glomerulus aplastic, abnormal AB/TU + MO2-osr1 standard conditions Fig. 4 with image,  Fig. 7 with image from Mudumana et al., 2008
hemangioblast cell differentiation disrupted, abnormal AB/TU + MO2-osr1 standard conditions Fig. 5 with image from Mudumana et al., 2008
endoderm development disrupted, abnormal AB/TU + MO2-osr1 standard conditions Fig. 10 with image from Mudumana et al., 2008
pronephric duct anterior region slc4a2a expression absent, abnormal AB/TU + MO2-osr1 standard conditions Fig. 4 from Tomar et al., 2014
pronephros development disrupted, abnormal AB/TU + MO2-osr1 standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 8 with image,  Fig. 11 with image from Mudumana et al., 2008
caudal vein plexus dilated, abnormal AB/TU + MO2-osr1 standard conditions Fig. 7 with image from Mudumana et al., 2008
pronephric podocyte mislocalised, abnormal AB/TU + MO2-osr1 standard conditions Fig. 4 from Tomar et al., 2014
pronephric podocyte morphology, abnormal AB/TU + MO2-osr1 standard conditions Fig. 4 with image from Mudumana et al., 2008
pronephric podocyte wt1b expression absent, abnormal WT + MO2-osr1 control Figure 5 with image from Drummond et al., 2022
pectoral fin development disrupted, abnormal WT + MO2-osr1 standard conditions Table 1 from Neto et al., 2012
pronephric podocyte absence of anatomical entity, abnormal WT + MO2-osr1 control Figure 5 with image from Drummond et al., 2022
pronephric podocyte apoptotic process increased process quality, abnormal WT + MO2-osr1 control Figure 2 with image from Drummond et al., 2022
intermediate mesoderm apoptotic process increased process quality, abnormal WT + MO2-osr1 control Figure 2 with image from Drummond et al., 2022
pectoral fin decreased size, abnormal WT + MO2-osr1 standard conditions Table 1 from Neto et al., 2012
pronephric glomerulus slit diaphragm nphs1 expression absent, abnormal WT + MO2-osr1 control Figure 5 with image from Drummond et al., 2022
pronephros development disrupted, abnormal mixl1m425/+ + MO2-osr1 standard conditions Fig. 11 with image from Mudumana et al., 2008
endoderm development disrupted, abnormal mixl1m425/+ + MO2-osr1 standard conditions Fig. 11 with image from Mudumana et al., 2008
pronephric tubule morphology, abnormal mixl1m425/+ + MO2-osr1 standard conditions Fig. 11 with image from Mudumana et al., 2008
endoderm development disrupted, abnormal mixl1m425/m425 + MO2-osr1 standard conditions Fig. 11 with image from Mudumana et al., 2008
pronephric duct anterior region slc4a2a expression amount, ameliorated AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
endodermal cell differentiation decreased occurrence, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 7 with image from Terashima et al., 2014
pronephric podocyte nphs1 expression absent, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
pronephric podocyte mislocalised, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
endoderm morphology, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 11 with image from Mudumana et al., 2008
hypoblast has fewer parts of type endodermal cell, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 7 with image from Terashima et al., 2014
endoderm development disrupted, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 11 with image from Mudumana et al., 2008
pronephric glomerulus morphogenesis disrupted, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
pronephric proximal tubule development process quality, ameliorated AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
pronephric podocyte nphs2 expression absent, abnormal AB/TU + MO2-osr1 + MO2-sox32 standard conditions Fig. 4 from Tomar et al., 2014
pectoral fin decreased size, abnormal WT + MO2-osr1 + MO2-osr2 standard conditions Table 1 from Neto et al., 2012
pectoral fin development disrupted, abnormal WT + MO2-osr1 + MO2-osr2 standard conditions Table 1 from Neto et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.