Morpholino
MO1-tbpl2
- ID
- ZDB-MRPHLNO-080303-1
- Name
- MO1-tbpl2
- Previous Names
-
- trf3-MO (1)
- Target
- Sequence
-
5' - GATGCCTCCTCATCCATGTTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbpl2
Expressed Gene | Anatomy | Figures |
---|---|---|
bmp4 |
Fig. 1
from Hart et al., 2007 |
|
cdx1a |
Fig. S9
from Hart et al., 2007 |
|
cdx4 |
|
Fig. 3,
Fig. S9
from Hart et al., 2007 |
dck |
Fig. 1
from Hart et al., 2007 |
|
gapdh |
Fig. 4 ![]() Fig. 3, Fig. S7, Fig. S9 from Hart et al., 2007 |
1 - 5 of 24 Show all
Phenotype
Phenotype resulting from MO1-tbpl2
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-tbpl2
1 - 5 of 5
Citations
- Hart, D.O., Santra, M.K., Raha, T., and Green, M.R. (2009) Selective interaction between Trf3 and Taf3 required for early development and hematopoiesis. Developmental Dynamics : an official publication of the American Association of Anatomists. 238(10):2540-2549
- Hart, D.O., Raha, T., Lawson, N.D., and Green, M.R. (2007) Initiation of zebrafish haematopoiesis by the TATA-box-binding protein-related factor Trf3. Nature. 450(7172):1082-1085
1 - 2 of 2
Show