Morpholino

MO2-tbxta

ID
ZDB-MRPHLNO-060809-2
Name
MO2-tbxta
Previous Names
  • MO2-ntl
  • MO2-ta
Target
Sequence
5' - GCTGGTCGGGACTTGAGGCAGACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tbxta
Expressed Gene Anatomy Figures
cp Fig. 5 with image from Nelson et al., 2017
foxa3 Fig. 5 with image from Nelson et al., 2017
ins Fig. 5 with image from Nelson et al., 2017
lft1 Fig. 3 with image from Regan et al., 2009
sox17 Fig. 4 with image from Nelson et al., 2017
sox32 Fig. 4 with image from Nelson et al., 2017
Phenotype
Phenotype resulting from MO2-tbxta
Phenotype Fish Figures
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta Fig. 5 with image from Nelson et al., 2017
determination of pancreatic left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta Fig. 5 with image from Nelson et al., 2017
digestive system foxa3 expression spatial pattern, abnormal AB + MO2-tbxta Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal AB + MO2-tbxta Fig. 5 with image from Nelson et al., 2017
liver position, abnormal AB + MO2-tbxta Fig. 5 with image from Nelson et al., 2017
liver cp expression spatial pattern, abnormal AB + MO2-tbxta Fig. 5 with image from Nelson et al., 2017
liver development process quality, abnormal AB + MO2-tbxta Fig. 5 with image from Nelson et al., 2017
pancreas position, abnormal AB + MO2-tbxta Fig. 5 with image from Nelson et al., 2017
pancreas ins expression spatial pattern, abnormal AB + MO2-tbxta Fig. 5 with image from Nelson et al., 2017
pancreas development process quality, abnormal AB + MO2-tbxta Fig. 5 with image from Nelson et al., 2017
Phenotype of all Fish created by or utilizing MO2-tbxta
Phenotype Fish Conditions Figures
pancreas development process quality, abnormal AB + MO2-tbxta standard conditions Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal AB + MO2-tbxta standard conditions Fig. 5 with image from Nelson et al., 2017
liver development process quality, abnormal AB + MO2-tbxta standard conditions Fig. 5 with image from Nelson et al., 2017
pancreas ins expression spatial pattern, abnormal AB + MO2-tbxta standard conditions Fig. 5 with image from Nelson et al., 2017
pancreas position, abnormal AB + MO2-tbxta standard conditions Fig. 5 with image from Nelson et al., 2017
determination of pancreatic left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta standard conditions Fig. 5 with image from Nelson et al., 2017
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta standard conditions Fig. 5 with image from Nelson et al., 2017
digestive system foxa3 expression spatial pattern, abnormal AB + MO2-tbxta standard conditions Fig. 5 with image from Nelson et al., 2017
liver position, abnormal AB + MO2-tbxta standard conditions Fig. 5 with image from Nelson et al., 2017
liver cp expression spatial pattern, abnormal AB + MO2-tbxta standard conditions Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
determination of pancreatic left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
pancreas development process quality, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
liver development process quality, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
determination of digestive tract left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta + MO2-tbxtb + MO4-tp53 standard conditions Fig. S3 with image from Nelson et al., 2017
liver development decreased occurrence, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
pancreas development decreased occurrence, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
whole organism sox32 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
whole organism mixl1 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
determination of digestive tract left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
liver cp expression absent, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm sox17 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
anatomical structure cxcl12b expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
whole organism gata5 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
pancreas ins expression absent, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endodermal cell decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
presumptive endoderm sox32 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
digestive system foxa3 expression spatial pattern, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
anatomical structure cxcl12a expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
gut malformed, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm EGFP expression decreased amount, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
endoderm EGFP expression spatial pattern, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.