Morpholino

MO4-rbpja,rbpjb

ID
ZDB-MRPHLNO-060626-6
Name
MO4-rbpja,rbpjb
Previous Names
  • MO2-rbpj (1)
  • MO2-rbpja (1)
  • MO2-rbpsuh (1)
  • MO4-rbpja+rbpjb
  • Su(H)-ORF-Mo (1)
Targets
Sequence
5' - CAAACTTCCCTGTCACAACAGGCGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino is predicted to target 2 genes.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-rbpja,rbpjb
Expressed Gene Anatomy Figures
cdh17 Fig. 3 with image from O'Brien et al., 2011
dlc Fig. 5 with image from Sacilotto et al., 2013
dll4 Fig. 4 with image from Sacilotto et al., 2013
efnb2a Fig. 5 with image from Sacilotto et al., 2013
Fig. S2 from Siekmann et al., 2007
flt1 Fig. S8 with image from Sacilotto et al., 2013
flt4 Fig. 5 with image from Sacilotto et al., 2013
Fig. 3 from Siekmann et al., 2007
foxb1a Fig. 2 from Qiu et al., 2009
her4.1 Fig. 2 from Qiu et al., 2009
Fig. 4,  Fig. 5 from Yeo et al., 2007
Fig. 6 with image from Zhang et al., 2007
her12 Fig. 5 with image from Shankaran et al., 2007
her15.1 Fig. 5 with image from Shankaran et al., 2007
hes6 Fig. 1 with image from Sieger et al., 2006
hey1 Fig. 3 with image from O'Brien et al., 2011
hey2 Fig. S8 with image from Sacilotto et al., 2013
mib1 Fig. 6 with image from Zhang et al., 2007
neurod1 Fig. 1 from Mizoguchi et al., 2011
notch1b Fig. S8 with image from Sacilotto et al., 2013
notch3 Fig. S8 with image from Sacilotto et al., 2013
nphs1 Fig. 3 with image from O'Brien et al., 2011
nr2f1a Fig. 9 with image from Wu et al., 2014
nr2f1b Fig. 6 with image from Li et al., 2015
nr5a1a Fig. 3 with image from O'Brien et al., 2011
pax2a Fig. 3 with image from O'Brien et al., 2011
podxl Fig. 3 with image from O'Brien et al., 2011
rfng Fig. 2 from Qiu et al., 2009
slc20a1a Fig. 3 with image from O'Brien et al., 2011
wt1b Fig. 3 with image from O'Brien et al., 2011
wu:fj67h05 Fig. 6 with image from Covassin et al., 2006
Phenotype
Phenotype resulting from MO4-rbpja,rbpjb
No data available
Phenotype of all Fish created by or utilizing MO4-rbpja,rbpjb
Phenotype Fish Conditions Figures
blood vessel nr2f1b expression increased distribution, abnormal TL + MO4-rbpja,rbpjb control Fig. 6 with image from Li et al., 2015
whole organism nr2f1b expression increased distribution, abnormal TL + MO4-rbpja,rbpjb control Fig. 6 with image from Li et al., 2015
pronephric tubule morphology, abnormal TU + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
interrenal primordium increased size, abnormal TU + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric podocyte decreased amount, abnormal TU + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
central nervous system cellular quality, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 5 from Yeo et al., 2007
angiogenic sprout increased amount, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
nucleate erythrocyte mislocalised, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. S2 from Siekmann et al., 2007
fin regeneration decreased process quality, abnormal WT + MO4-rbpja,rbpjb physical alteration: anatomical structure Fig. 3 with image from Münch et al., 2013
ventricular system distended, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. S2 from Siekmann et al., 2007
posterior lateral line ganglion neuron increased amount, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 1 from Mizoguchi et al., 2011
ventricular system increased accumulation nucleate erythrocyte, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. S2 from Siekmann et al., 2007
hindbrain epithelium disorganized, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 2 from Qiu et al., 2009
cranial vasculature broken, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. S2 from Siekmann et al., 2007
intersegmental vessel structure, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
rhombomere boundary formation disrupted, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 2 from Qiu et al., 2009
blood vessel endothelial cell proliferation involved in sprouting angiogenesis process quality, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
hindbrain development disrupted, abnormal WT + MO4-rbpja,rbpjb standard conditions Fig. 2 from Qiu et al., 2009
pronephric podocyte decreased amount, abnormal TU + MO1-foxc1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric tubule morphology, abnormal TU + MO1-foxc1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
interrenal primordium increased size, abnormal TU + MO1-foxc1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric tubule absent, abnormal TU + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
interrenal primordium increased size, abnormal TU + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric podocyte decreased amount, abnormal TU + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
whole organism lacks all parts of type dorsal aorta, abnormal WT + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with image,  Fig. 5 with image from Sacilotto et al., 2013
axial blood vessel decreased amount, abnormal WT + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 5 with image from Sacilotto et al., 2013
artery development arrested, abnormal WT + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with image,  Fig. 5 with image,  Fig. S8 with image from Sacilotto et al., 2013
pronephros lacks all parts of type pronephric podocyte, abnormal hnf1bahi1843Tg/hi1843Tg + MO1-hnf1bb + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 4 from Naylor et al., 2013
podocyte differentiation decreased occurrence, abnormal hnf1bahi1843Tg/hi1843Tg + MO1-hnf1bb + MO3-wt1a + MO4-rbpja,rbpjb standard conditions Fig. 4 from Naylor et al., 2013
peripheral neuron decreased length, abnormal knu2Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 from So et al., 2009
blood vessel endothelial cell proliferation involved in sprouting angiogenesis process quality, abnormal lcr1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
trunk vasculature EGFP expression decreased amount, abnormal lcr1Tg + MO4-rbpja,rbpjb control Fig. 3 with image from Overman et al., 2017
angiogenic sprout increased amount, abnormal lcr1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
intersegmental vessel structure, abnormal lcr1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Sacilotto et al., 2013
trunk vasculature EGFP expression decreased amount, abnormal lcr1Tg + MO4-rbpja,rbpjb chemical treatment by environment: pharmaceutical Fig. 3 with image from Overman et al., 2017
whole organism EGFP expression decreased amount, abnormal lcr1Tg + MO4-rbpja,rbpjb chemical treatment by environment: pharmaceutical Fig. 3 with image from Overman et al., 2017
intersegmental vessel increased branchiness, abnormal s843Tg + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis increased process quality, abnormal s843Tg + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
blood circulation disrupted, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. S1 from Siekmann et al., 2007
intersegmental vessel structure, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 1 from Siekmann et al., 2007
intersegmental vessel increased mass density, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Jensen et al., 2012
blood vessel development disrupted, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 5 with image from Sacilotto et al., 2013
intersegmental vessel disorganized, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Jensen et al., 2012
intersegmental vessel has extra parts of type blood vessel, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Jensen et al., 2012
intersegmental vessel mislocalised, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 1 from Siekmann et al., 2007
intersegmental vessel has extra parts of type vascular sprouts, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. 4 with image from Jensen et al., 2012
intersegmental artery structure, abnormal y1Tg + MO4-rbpja,rbpjb standard conditions Fig. S1 from Siekmann et al., 2007
intersegmental vessel structure, abnormal y7Tg + MO4-rbpja,rbpjb standard conditions Fig. 2 from Siekmann et al., 2007
blood vessel endothelial cell increased amount, abnormal y7Tg + MO4-rbpja,rbpjb standard conditions Fig. 2 from Siekmann et al., 2007
cell migration involved in sprouting angiogenesis process quality, abnormal y7Tg + MO4-rbpja,rbpjb standard conditions Fig. 2 from Siekmann et al., 2007
blood vessel endothelial cell proliferation involved in sprouting angiogenesis process quality, abnormal y7Tg + MO4-rbpja,rbpjb standard conditions Fig. 2 from Siekmann et al., 2007
intersegmental artery blood vessel endothelial cell increased amount, abnormal y7Tg + MO4-rbpja,rbpjb control Fig. 5 with image from Lamont et al., 2016
Fig. 3,  Fig. S5 from Siekmann et al., 2007
dorsal longitudinal anastomotic vessel blood vessel development occurrence, ameliorated s843Tg + MO2-uxt + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
intersegmental vessel angiogenesis process quality, ameliorated s843Tg + MO2-uxt + MO4-rbpja,rbpjb standard conditions Fig. 7 with image from Zhou et al., 2015
intersegmental artery blood vessel endothelial cell amount, ameliorated y7Tg + MO4-isl2a + MO4-rbpja,rbpjb + MO5-isl2a control Fig. 5 with image from Lamont et al., 2016
artery development arrested, abnormal lcr1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with image from Sacilotto et al., 2013
whole organism lacks all parts of type dorsal aorta, abnormal lcr1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 4 with image from Sacilotto et al., 2013
artery development arrested, abnormal y1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 5 with image from Sacilotto et al., 2013
axial blood vessel decreased amount, abnormal y1Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. 5 with image from Sacilotto et al., 2013
intersegmental vessel cell increased amount, abnormal ci5Tg; y7Tg + MO4-rbpja,rbpjb standard conditions Fig. 6 with image from Li et al., 2015
intersegmental vessel cell amount, ameliorated ci5Tg; y7Tg + MO4-nr2f1b + MO4-rbpja,rbpjb standard conditions Fig. 6 with image from Li et al., 2015
ventral wall of dorsal aorta endothelial cell EGFP expression absent, abnormal gfi1aaqmc551Gt/+; sd2Tg + MO4-rbpja,rbpjb control Fig. 4 with image from Thambyrajah et al., 2016
hematopoietic multipotent progenitor cell EGFP expression absent, abnormal gfi1aaqmc551Gt/+; sd2Tg + MO4-rbpja,rbpjb control Fig. 4 with image from Thambyrajah et al., 2016
ventral wall of dorsal aorta hematopoietic cell EGFP expression absent, abnormal gfi1aaqmc551Gt/+; sd2Tg + MO4-rbpja,rbpjb control Fig. 4 with image from Thambyrajah et al., 2016
blood circulation arrested, abnormal s843Tg; sd2Tg + MO4-rbpja,rbpjb + MO5-sox18 + MO5-sox7 standard conditions Fig. S7 with image from Sacilotto et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.