Morpholino

MO2-lef1

ID

ZDB-MRPHLNO-060214-6

Name

MO2-lef1

Previous Names

None

Target

lef1 (1)

Sequence

5' - ACTGCCTGGATGAAACACTTACATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-lef1

Expressed Gene	Anatomy	Figures
ascl1a	forebrain (not) hypothalamus	Fig. 4 from Lee et al., 2006
barhl2	diencephalon telencephalon	Fig. S6 from Russek-Blum et al., 2008
dhrs9	intestine	Fig. 5 from Rai et al., 2010
dlx2a	forebrain (not) hypothalamus	Fig. 4 from Lee et al., 2006
dmbx1a	hindbrain optic tectum	Fig. 3 from Bonkowsky et al., 2008
emx2	hypothalamus	Fig. 3 from Lee et al., 2006
fabp2	intestine	Fig. 5 from Rai et al., 2010
foxp2	(not) hindbrain (not) midbrain hindbrain boundary (not) optic tectum telencephalon	Fig. 3 , Fig. S1 from Bonkowsky et al., 2008
isl1a	forebrain (not) hypothalamus	Fig. 4 from Lee et al., 2006
lef1	(not) whole organism	Fig. S1 from Lee et al., 2006
neurog1	caudal tuberculum forebrain	Fig. 4 from Lee et al., 2006
nkx2.4b	hypothalamus	Fig. 3 from Lee et al., 2006
olig2	caudal tuberculum forebrain	Fig. 4 from Lee et al., 2006
prss1	pancreas	Fig. 5 from Rai et al., 2010
rbp3	(not) retina	Fig. 5 from Rai et al., 2010
rx3	hypothalamus	Fig. 3 from Lee et al., 2006
slc6a3	diencephalon dopaminergic neuron	Fig. 8 from Russek-Blum et al., 2008
sox3	forebrain (not) hypothalamus	Fig. 4 from Lee et al., 2006
th	diencephalon dopaminergic neuron	Fig. S6 from Russek-Blum et al., 2008
zic2a	brain diencephalon hindbrain midbrain neural tube optic stalk telencephalon	Fig. 2 from Ota et al., 2012 Fig. 6 from Nyholm et al., 2007

Phenotype

Phenotype resulting from MO2-lef1

Phenotype	Fish	Figures
brain wholly posteriorized, abnormal	WT + MO2-lef1	Fig. 6 from Nyholm et al., 2007
cartilage morphogenesis disrupted, abnormal	WT + MO2-lef1	Fig. 1 from Ishitani et al., 2005
cell proliferation in midbrain decreased occurrence, abnormal	WT + MO2-lef1	Fig. 2 from Ota et al., 2012
cranial cartilage morphology, abnormal	WT + MO2-lef1	Fig. 1 from Ishitani et al., 2005
diencephalon dopaminergic neuron increased amount, abnormal	WT + MO2-lef1	Fig. 8 , Fig. S6 from Russek-Blum et al., 2008
dorsal root ganglion decreased amount, abnormal	WT + MO2-lef1	Fig. 1 from Ishitani et al., 2005
dorsal root ganglion mislocalised, abnormal	WT + MO2-lef1	Fig. 1 from Ishitani et al., 2005
forebrain neuron development disrupted, abnormal	WT + MO2-lef1	Fig. 4 from Lee et al., 2006
hypothalamus axon decreased amount, abnormal	WT + MO2-lef1	Fig. 5 from Lee et al., 2006
hypothalamus neuron decreased amount, abnormal	WT + MO2-lef1	Fig. 5 from Lee et al., 2006
hypothalamus neuron morphology, abnormal	WT + MO2-lef1	Fig. 4 from Lee et al., 2006
hypothalamus cell differentiation disrupted, abnormal	WT + MO2-lef1	Fig. 5 from Lee et al., 2006
mandibular arch skeleton decreased size, abnormal	WT + MO2-lef1	Fig. 1 from Ishitani et al., 2005
midbrain morphology, abnormal	WT + MO2-lef1	Fig. 6 from Nyholm et al., 2007
midbrain development disrupted, abnormal	rw0130aTg + MO2-lef1	Fig. 2 from Ota et al., 2012
neural crest cell development disrupted, abnormal	WT + MO2-lef1	Fig. 1 from Ishitani et al., 2005
optic tectum decreased size, abnormal	rw0130aTg + MO2-lef1 + MO4-tp53	Fig. 2 from Ota et al., 2012

Phenotype of all Fish created by or utilizing MO2-lef1

Phenotype	Fish	Conditions	Figures
brain wholly posteriorized, abnormal	WT + MO2-lef1	standard conditions	Fig. 6 from Nyholm et al., 2007
dorsal root ganglion decreased amount, abnormal	WT + MO2-lef1	standard conditions	Fig. 1 from Ishitani et al., 2005
dorsal root ganglion mislocalised, abnormal	WT + MO2-lef1	standard conditions	Fig. 1 from Ishitani et al., 2005
neural crest cell development disrupted, abnormal	WT + MO2-lef1	standard conditions	Fig. 1 from Ishitani et al., 2005
cranial cartilage morphology, abnormal	WT + MO2-lef1	standard conditions	Fig. 1 from Ishitani et al., 2005
midbrain morphology, abnormal	WT + MO2-lef1	standard conditions	Fig. 6 from Nyholm et al., 2007
hypothalamus cell differentiation disrupted, abnormal	WT + MO2-lef1	standard conditions	Fig. 5 from Lee et al., 2006
diencephalon dopaminergic neuron increased amount, abnormal	WT + MO2-lef1	standard conditions	Fig. 8 , Fig. S6 from Russek-Blum et al., 2008
hypothalamus neuron decreased amount, abnormal	WT + MO2-lef1	standard conditions	Fig. 5 from Lee et al., 2006
mandibular arch skeleton decreased size, abnormal	WT + MO2-lef1	standard conditions	Fig. 1 from Ishitani et al., 2005
hypothalamus neuron morphology, abnormal	WT + MO2-lef1	standard conditions	Fig. 4 from Lee et al., 2006
forebrain neuron development disrupted, abnormal	WT + MO2-lef1	standard conditions	Fig. 4 from Lee et al., 2006
cartilage morphogenesis disrupted, abnormal	WT + MO2-lef1	standard conditions	Fig. 1 from Ishitani et al., 2005
hypothalamus axon decreased amount, abnormal	WT + MO2-lef1	standard conditions	Fig. 5 from Lee et al., 2006
cell proliferation in midbrain decreased occurrence, abnormal	WT + MO2-lef1	standard conditions	Fig. 2 from Ota et al., 2012
midbrain development disrupted, abnormal	rw0130aTg + MO2-lef1	standard conditions	Fig. 2 from Ota et al., 2012
optic tectum decreased size, abnormal	rw0130aTg + MO2-lef1	standard conditions	Fig. 2 from Ota et al., 2012
midbrain development disrupted, abnormal	rw0130aTg + MO2-lef1 + MO4-tp53	standard conditions	Fig. 2 from Ota et al., 2012
optic tectum decreased size, abnormal	rw0130aTg + MO2-lef1 + MO4-tp53	standard conditions	Fig. 2 from Ota et al., 2012
retina development in camera-type eye disrupted, abnormal	apc^hu745/hu745 + MO2-lef1	standard conditions	Fig. 5 from Rai et al., 2010
retina immature, abnormal	apc^hu745/hu745 + MO2-lef1	standard conditions	Fig. 5 from Rai et al., 2010

Citations