CRISPR

CRISPR1-mto1

ID

ZDB-CRISPR-220217-1

Name

CRISPR1-mto1

Previous Names

None

Target

mto1 (1)

Sequence

5' - ACGGTCCAGTTGGGCTCTGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3385	mto1

Expression

Gene expression in Wild Types + CRISPR1-mto1

No data available

Phenotype

Phenotype resulting from CRISPR1-mto1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-mto1

Phenotype	Fish	Conditions	Figures
whole organism lysyl-tRNA aminoacylation decreased occurrence, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 3. from Zhang et al., 2021
cardiac muscle cell mitochondrial crista decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 2. from Zhang et al., 2021
heart looping disrupted, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 1. from Zhang et al., 2021
whole organism mtpap expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 8. from Zhang et al., 2021
cardiac muscle cell mitochondrion fragmented, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 2. from Zhang et al., 2021
cytochrome-c oxidase activity decreased occurrence, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 6. from Zhang et al., 2021
whole organism Ab1-cox5a labeling decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 6. from Zhang et al., 2021
mitochondrial electron transport, NADH to ubiquinone decreased occurrence, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 6. from Zhang et al., 2021
mitochondrial mRNA polyadenylation decreased occurrence, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 8. from Zhang et al., 2021
mitochondrial electron transport, ubiquinol to cytochrome c decreased occurrence, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 6. from Zhang et al., 2021
cardiac muscle cell I band increased length, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 2. from Zhang et al., 2021
whole organism mt-co2 expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 5. from Zhang et al., 2021
whole organism glycyl-tRNA aminoacylation decreased occurrence, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 3. from Zhang et al., 2021
heart pnpo expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 7. from Zhang et al., 2021
whole organism tRNA(Gly) structure, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 4. from Zhang et al., 2021
heart aco2 expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 7. from Zhang et al., 2021
heart mto1 expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 7. from Zhang et al., 2021
heart tnrc6ba expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 7. from Zhang et al., 2021
whole organism leucyl-tRNA aminoacylation decreased occurrence, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 3. from Zhang et al., 2021
heart pgp expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 7. from Zhang et al., 2021
whole organism Ab1-ndufs1 labeling decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 6. from Zhang et al., 2021
heart mtpap expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 7. from Zhang et al., 2021
heart ep300a expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 7. from Zhang et al., 2021
whole organism Ab1-atp5c1 labeling decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 6. from Zhang et al., 2021
whole organism tRNA(Trp) structure, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 4. from Zhang et al., 2021
whole organism tRNA(Lys) structure, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 4. from Zhang et al., 2021
whole organism tufm expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 5. from Zhang et al., 2021
cardiac muscle cell hypertrophic, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 2. from Zhang et al., 2021
heart lpla expression increased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 7. from Zhang et al., 2021
whole organism tRNA(Leu) structure, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 4. from Zhang et al., 2021
whole organism tryptophanyl-tRNA aminoacylation decreased occurrence, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 3. from Zhang et al., 2021
heart mrtfab expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 7. from Zhang et al., 2021
whole organism mt-nd1 expression decreased amount, abnormal	mto1^{zf3385/zf3385} (AB)	standard conditions	Figure 5. from Zhang et al., 2021
whole organism tryptophanyl-tRNA aminoacylation decreased occurrence, abnormal	mto1^zf3385/+ (AB)	standard conditions	Figure 3. from Zhang et al., 2021
mitochondrial electron transport, ubiquinol to cytochrome c decreased occurrence, abnormal	mto1^zf3385/+ (AB)	standard conditions	Figure 6. from Zhang et al., 2021
cardiac muscle cell mitochondrion fragmented, abnormal	mto1^zf3385/+ (AB)	standard conditions	Figure 2. from Zhang et al., 2021
cytochrome-c oxidase activity decreased occurrence, abnormal	mto1^zf3385/+ (AB)	standard conditions	Figure 6. from Zhang et al., 2021
whole organism glycyl-tRNA aminoacylation decreased occurrence, abnormal	mto1^zf3385/+ (AB)	standard conditions	Figure 3. from Zhang et al., 2021
whole organism mt-co2 expression decreased amount, abnormal	mto1^zf3385/+ (AB)	standard conditions	Figure 5. from Zhang et al., 2021
whole organism leucyl-tRNA aminoacylation decreased occurrence, abnormal	mto1^zf3385/+ (AB)	standard conditions	Figure 3. from Zhang et al., 2021
whole organism Ab1-cox5a labeling decreased amount, abnormal	mto1^zf3385/+ (AB)	standard conditions	Figure 6. from Zhang et al., 2021
cardiac muscle cell hypertrophic, abnormal	mto1^zf3385/+ (AB)	standard conditions	Figure 2. from Zhang et al., 2021
whole organism tufm expression decreased amount, abnormal	mto1^zf3385/+ (AB)	standard conditions	Figure 5. from Zhang et al., 2021
whole organism mt-nd1 expression decreased amount, abnormal	mto1^zf3385/+ (AB)	standard conditions	Figure 5. from Zhang et al., 2021

Citations