CRISPR

CRISPR1-eif2b5

ID

ZDB-CRISPR-210816-1

Name

CRISPR1-eif2b5

Previous Names

None

Target

eif2b5 (1)

Sequence

5' - GCCACCAGAACGGCCTGCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "CGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zc101	eif2b5
zc102	eif2b5
zc103	eif2b5
zc104	eif2b5
zc105	eif2b5
zc106	eif2b5

Expression

Gene expression in Wild Types + CRISPR1-eif2b5

No data available

Phenotype

Phenotype resulting from CRISPR1-eif2b5

No data available

Phenotype of all Fish created by or utilizing CRISPR1-eif2b5

Phenotype	Fish	Conditions	Figures
optic tectum neuron proliferative, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 5 from Keefe et al., 2020
axis cell population proliferation increased occurrence, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 5 from Keefe et al., 2020
axis microglial cell proliferative, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 5 from Keefe et al., 2020
microglial cell proliferative, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 5 from Keefe et al., 2020
head decreased size, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 2 from Keefe et al., 2020
spinal cord glioblast apoptotic, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 4 from Keefe et al., 2020
axis radial glial cell proliferative, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 5 from Keefe et al., 2020
swimming decreased occurrence, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 2 from Keefe et al., 2020
optic tectum cell population proliferation decreased occurrence, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 3 from Keefe et al., 2020
brain apoptotic process increased occurrence, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 3 , Figure 4 , Figure 5 from Keefe et al., 2020
neuron cell population proliferation decreased occurrence, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 5 from Keefe et al., 2020
hindbrain glioblast apoptotic, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 4 from Keefe et al., 2020
whole organism decreased size, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 2 from Keefe et al., 2020
swim bladder absent, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 2 from Keefe et al., 2020
glioblast apoptotic process increased occurrence, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 4 from Keefe et al., 2020
radial glial cell apoptotic process increased occurrence, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 5 from Keefe et al., 2020
whole organism dead, abnormal	eif2b5^zc102/zc102	standard conditions	Figure 2 from Keefe et al., 2020
axis cell population proliferation increased occurrence, abnormal	eif2b5^zc103/zc103	standard conditions	Figure 5 from Keefe et al., 2020
cranial nerve II myelin sheath decreased thickness, abnormal	eif2b5^zc103/zc103	standard conditions	Figure 6 from Keefe et al., 2020
swimming occurrence, ameliorated	eif2b5^zc103/zc103	chemical treatment by environment: lithium chloride	Figure 2 from Witkamp et al., 2024
axis radial glial cell proliferative, abnormal	eif2b5^zc103/zc103	standard conditions	Figure 5 from Keefe et al., 2020
spinal cord glioblast apoptotic, abnormal	eif2b5^zc103/zc103	standard conditions	Figure 4 from Keefe et al., 2020
swimming decreased occurrence, abnormal	eif2b5^zc103/zc103	control	Figure 2 from Witkamp et al., 2024
brain apoptotic process increased occurrence, abnormal	eif2b5^zc103/zc103	standard conditions	Figure 3 , Figure 4 from Keefe et al., 2020
hindbrain glioblast apoptotic, abnormal	eif2b5^zc103/zc103	standard conditions	Figure 4 from Keefe et al., 2020
brain decreased size, abnormal	eif2b5^zc103/zc103	standard conditions	Figure 6 from Keefe et al., 2020
whole organism decreased size, abnormal	eif2b5^zc103/zc103	standard conditions	Figure 2 from Keefe et al., 2020
glioblast apoptotic process increased occurrence, abnormal	eif2b5^zc103/zc103	standard conditions	Figure 4 from Keefe et al., 2020
cranial nerve II axon decreased diameter, abnormal	eif2b5^zc103/zc103	standard conditions	Figure 6 from Keefe et al., 2020
hindbrain glioblast apoptotic, abnormal	eif2b5^zc102/zc102; vu19Tg	standard conditions	Figure 3 from Keefe et al., 2020
glioblast apoptotic process increased occurrence, abnormal	eif2b5^zc102/zc102; vu19Tg	standard conditions	Figure 3 from Keefe et al., 2020
hindbrain glioblast apoptotic, abnormal	eif2b5^zc103/zc103; vu19Tg	standard conditions	Figure 3 from Keefe et al., 2020
glioblast apoptotic process increased occurrence, abnormal	eif2b5^zc103/zc103; vu19Tg	standard conditions	Figure 3 from Keefe et al., 2020

Citations