CRISPR

CRISPR1-foxf1

ID

ZDB-CRISPR-190108-4

Name

CRISPR1-foxf1

Previous Names

None

Target

foxf1 (1)

Sequence

5' - GGGACGACGAATTCCAGCGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
el658	foxf1
el660	foxf1

Expression

Gene expression in Wild Types + CRISPR1-foxf1

No data available

Phenotype

Phenotype resulting from CRISPR1-foxf1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-foxf1

Phenotype	Fish	Conditions	Figures
intestine decreased size, abnormal	foxf1^el658/el658	standard conditions	Fig. S5 from Xu et al., 2018
swim bladder uninflated, abnormal	foxf1^el658/el658	standard conditions	Fig. S5 from Xu et al., 2018
basihyal cartilage decreased size, abnormal	foxf1^el658/el658; foxf2a^el616/el616	standard conditions	Fig. 3 from Xu et al., 2018
basibranchial morphology, abnormal	foxf1^el658/el658; foxf2a^el616/el616	standard conditions	Fig. 3 from Xu et al., 2018
ceratohyal cartilage decreased size, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/+	standard conditions	Fig. 3 from Xu et al., 2018
whole organism lacks all parts of type basibranchial, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/+	standard conditions	Fig. 3 from Xu et al., 2018
pterygoid process decreased size, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/+	standard conditions	Fig. 3 from Xu et al., 2018
whole organism lacks all parts of type basihyal cartilage, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/+	standard conditions	Fig. 3 from Xu et al., 2018
whole organism has fewer parts of type ceratobranchial 5 tooth, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/+	standard conditions	Fig. 3 from Xu et al., 2018
pharyngeal arch 1 hand2 expression decreased distribution, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/+	standard conditions	Fig. 4 from Xu et al., 2018
Meckel's cartilage decreased size, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/+	standard conditions	Fig. 3 from Xu et al., 2018
Meckel's cartilage col2a1a expression decreased distribution, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 5 from Xu et al., 2018
pharyngeal arch 1 cartilage development decreased occurrence, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
whole organism lacks all parts of type tooth 4V, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
ethmoid cartilage decreased size, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
ceratohyal cartilage decreased size, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
ceratobranchial 5 primary tooth fgf3 expression absent, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
ceratobranchial 5 primary tooth dlx2b expression absent, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
whole organism lacks all parts of type tooth 5V, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
Meckel's cartilage matn4 expression decreased distribution, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 5 from Xu et al., 2018
whole organism lacks all parts of type basibranchial, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
neurocranium cartilage development decreased occurrence, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
whole organism lacks all parts of type neurocranial trabecula, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
whole organism lacks all parts of type tooth 3V, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
Meckel's cartilage matn1 expression decreased distribution, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 5 from Xu et al., 2018
whole organism lacks all parts of type basihyal cartilage, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
whole organism has fewer parts of type ceratobranchial 5 tooth, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
Meckel's cartilage decreased size, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
pterygoid process decreased size, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
pharyngeal arch 2 cartilage development decreased occurrence, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018
Meckel's cartilage acana expression decreased distribution, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 5 from Xu et al., 2018
head decreased size, abnormal	foxf1^el658/el658; foxf2a^el616/el616; foxf2b^el621/el621	standard conditions	Fig. 3 from Xu et al., 2018

Citations