CRISPR

CRISPR2-mfrp

ID
ZDB-CRISPR-180816-2
Name
CRISPR2-mfrp
Previous Names
None
Target
Sequence
5' - GGGTAAGGCTTCGGGTGGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targets exon 8
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mw78 mfrp
mw79 mfrp
Expression
Gene expression in Wild Types + CRISPR2-mfrp
No data available
Phenotype
Phenotype resulting from CRISPR2-mfrp
No data available
Phenotype of all Fish created by or utilizing CRISPR2-mfrp
Phenotype Fish Conditions Figures
retinal pigmented epithelium mfrp expression absent, abnormal mfrpmw78/mw78 standard conditions Fig. 2 with image from Collery et al., 2016
optokinetic behavior decreased occurrence, abnormal mfrpmw78/mw78 standard conditions Fig. 8 with image from Collery et al., 2016
eye transverse plane decreased length, abnormal mfrpmw78/mw78 standard conditions Fig. 3 with image from Collery et al., 2016
eye decreased size, abnormal mfrpmw78/mw78 standard conditions Fig. 3 with image from Collery et al., 2016
retina decreased size, abnormal mfrpmw78/mw78 standard conditions Fig. 4 with image from Collery et al., 2016
retinal pigmented epithelium folded, abnormal mfrpmw78/mw78 standard conditions Fig. 4 with image from Collery et al., 2016
retinal neural layer folded, abnormal mfrpmw78/mw78 standard conditions Fig. 4 with image from Collery et al., 2016
retinal inner nuclear layer macrophage decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retinal outer nuclear layer macrophage decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
whole organism shortened, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 4 with image from Brandt et al., 2021
retinal ganglion cell layer macrophage decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retinal inner nuclear layer ab5-lcp1 labeling decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
eye decreased curvature, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 4 with image from Brandt et al., 2021
retinal ganglion cell layer ab5-lcp1 labeling decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retina macrophage ab5-lcp1 labeling decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retina macrophage ab9-gfp labeling decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retina macrophage decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 2 with image from Brandt et al., 2021
retinal inner nuclear layer ab9-gfp labeling decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retinal outer nuclear layer cell division decreased frequency, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 6 with image from Brandt et al., 2021
retinal ganglion cell layer ab9-gfp labeling decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retina macrophage ab-4c4 labeling decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 2 with image from Brandt et al., 2021
retinal outer nuclear layer ab9-gfp labeling decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retinal outer nuclear layer ab5-lcp1 labeling decreased amount, abnormal mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
sclera collagen fibril organization decreased process quality, exacerbated mfrpmw78/+; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 7 with image from Brandt et al., 2021
sclera positive regulation of collagen binding decreased process quality, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 8 with image from Brandt et al., 2021
whole organism shortened, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 4 with image from Brandt et al., 2021
retina macrophage decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 2 with image from Brandt et al., 2021
retinal inner nuclear layer macrophage decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retinal ganglion cell layer macrophage decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retinal outer nuclear layer cell division decreased frequency, abnormal mfrpmw78/mw78; w202Tg/w202Tg standard conditions Fig. 6 with image from Brandt et al., 2021
retinal outer nuclear layer macrophage decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retinal inner nuclear layer ab5-lcp1 labeling decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
eye decreased size, abnormal mfrpmw78/mw78; w202Tg/w202Tg standard conditions Fig. 4 with image from Brandt et al., 2021
eye decreased curvature, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 4 with image from Brandt et al., 2021
retinal ganglion cell layer ab5-lcp1 labeling decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retina macrophage ab9-gfp labeling decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retinal inner nuclear layer ab9-gfp labeling decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retina macrophage ab5-lcp1 labeling decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retinal outer nuclear layer cell division decreased frequency, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 6 with image from Brandt et al., 2021
retinal outer nuclear layer ab9-gfp labeling decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retinal ganglion cell layer ab9-gfp labeling decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
retinal outer nuclear layer ab5-lcp1 labeling decreased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 3 with image from Brandt et al., 2021
sclera collagen fibril organization decreased process quality, abnormal mfrpmw78/mw78; w202Tg/w202Tg standard conditions Fig. 7 with image from Brandt et al., 2021
sclera collagen fibril organization decreased process quality, exacerbated mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 7 with image from Brandt et al., 2021
eye decreased size, abnormal mfrpmw78/mw78; w202Tg/w202Tg chemical treatment by environment: metronidazole Fig. 4 with image from Brandt et al., 2021
retina macrophage increased amount, abnormal mfrpmw78/mw78; w202Tg/w202Tg standard conditions Fig. 2 with image from Brandt et al., 2021
Citations