TALEN

TALEN1-fscn1a

ID

ZDB-TALEN-150526-1

Name

TALEN1-fscn1a

Previous Names

None

Target

fscn1a (1)

Target Sequence 1

5' - CGGCTTCAAGATCAATGCAT - 3'

Target Sequence 2

5' - CCAAATCTGCTTCTTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zd1011	fscn1a
zd1012	fscn1a
zd1013	fscn1a

Expression

Gene expression in Wild Types + TALEN1-fscn1a

No data available

Phenotype

Phenotype resulting from TALEN1-fscn1a

No data available

Phenotype of all Fish created by or utilizing TALEN1-fscn1a

Phenotype	Fish	Conditions	Figures
sympathetic nervous system decreased size, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 7 from Boer et al., 2015
pharyngeal arch 1 morphology, abnormal	fscn1a^{zd1011/zd1011}	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
palatoquadrate cartilage absent, abnormal	fscn1a^{zd1011/zd1011}	control	Fig. 5 , Fig. 6 from Boer et al., 2015
pharyngeal arch 1 cranial neural crest misrouted, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 4 from Boer et al., 2015
pharyngeal arch 1 neural crest cell migration process quality, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 4 from Boer et al., 2015
splanchnocranium morphology, abnormal	fscn1a^{zd1011/zd1011}	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
splanchnocranium morphology, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 2 , Fig. 6 , Fig. 8 from Boer et al., 2015
cranial neural crest misrouted, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 4 from Boer et al., 2015
pharyngeal arch 1 absent, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 5 from Boer et al., 2015
Meckel's cartilage absent, abnormal	fscn1a^{zd1011/zd1011}	control	Fig. 5 , Fig. 6 from Boer et al., 2015
swim bladder morphology, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 2 from Boer et al., 2015
cranial neural crest neural crest cell migration process quality, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 4 from Boer et al., 2015
Meckel's cartilage absent, abnormal	fscn1a^{zd1011/zd1011}	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
sympathetic nervous system malformed, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 7 from Boer et al., 2015
heart morphology, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 2 from Boer et al., 2015
sympathetic nervous system development process quality, abnormal	fscn1a^{zd1011/zd1011}	standard conditions	Fig. 7 , Fig. S9 from Boer et al., 2015
palatoquadrate cartilage absent, abnormal	fscn1a^{zd1011/zd1011}	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
pharyngeal arch 1 morphology, abnormal	fscn1a^{zd1011/zd1011}	control	Fig. 5 , Fig. 6 from Boer et al., 2015
enteric neuron decreased amount, abnormal	fscn1a^{zd1011/zd1011}; w37Tg	standard conditions	Fig. 7 from Boer et al., 2015
sympathetic nervous system malformed, abnormal	fscn1a^{zd1011/zd1011}; zdf15Tg	standard conditions	Fig. 7 from Boer et al., 2015
sympathetic nervous system development process quality, abnormal	fscn1a^{zd1011/zd1011}; zdf15Tg	standard conditions	Fig. 7 from Boer et al., 2015
cranial neural crest filopodium decreased amount, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg	control	Fig. 3 , Fig. 6 , Fig. 8 from Boer et al., 2015
cranial neural crest filopodium decreased length, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
cranial neural crest filopodium decreased amount, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg	chemical treatment: pharmaceutical	Fig. 6 from Boer et al., 2015
cranial neural crest filopodium decreased length, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg	control	Fig. 3 , Fig. 6 , Fig. 8 from Boer et al., 2015
splanchnocranium morphology, abnormal	fscn1a^{zd1011/zd1011} + MO2-cxcr4a	standard conditions	Fig. 8 from Boer et al., 2015
sympathetic nervous system development process quality, abnormal	fscn1a^{zd1011/zd1011} + MO2-cxcr4a	standard conditions	Fig. S9 from Boer et al., 2015
cranial neural crest filopodium decreased amount, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg + MO2-cxcr4a	standard conditions	Fig. 8 from Boer et al., 2015
cranial neural crest filopodium decreased length, abnormal	fscn1a^{zd1012/zd1012}; vu234Tg + MO2-cxcr4a	standard conditions	Fig. 8 from Boer et al., 2015

Citations