Morpholino

MO1-tpd52

ID
ZDB-MRPHLNO-211025-1
Name
MO1-tpd52
Previous Names
None
Target
Sequence
5' - ACAGCACTGAAAGATGTTGACCTTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tpd52
Expressed Gene Anatomy Figures
itga2b Fig. 4 from Kang et al., 2020
lcp1 Fig. 3 from Kang et al., 2020
mpx Fig. 3 from Kang et al., 2020
myb Fig. 4 from Kang et al., 2020
runx1 Fig. 4 from Kang et al., 2020
tpd52 Fig. 2 from Kang et al., 2020
Phenotype
Phenotype resulting from MO1-tpd52
Phenotype Fish Figures
caudal hematopoietic tissue cell population proliferation decreased process quality, abnormal AB + MO1-tpd52 Fig. 5 from Kang et al., 2020
caudal hematopoietic tissue hematopoietic stem cell myb expression decreased distribution, abnormal AB + MO1-tpd52 Fig. 4 from Kang et al., 2020
caudal hematopoietic tissue hematopoietic stem cell EGFP expression decreased distribution, abnormal la2Tg + MO1-tpd52 (AB) Fig. 4 from Kang et al., 2020
dorsal aorta hematopoietic stem cell runx1 expression decreased distribution, abnormal AB + MO1-tpd52 Fig. 4 from Kang et al., 2020
neutrophil decreased amount, abnormal AB + MO1-tpd52 Fig. 3 from Kang et al., 2020
whole organism tpd52 expression decreased amount, abnormal AB + MO1-tpd52 Fig. 2 from Kang et al., 2020
whole organism mpx expression decreased amount, abnormal AB + MO1-tpd52 Fig. 3 from Kang et al., 2020
whole organism lcp1 expression decreased amount, abnormal AB + MO1-tpd52 Fig. 3 from Kang et al., 2020
whole organism itga2b expression decreased amount, abnormal AB + MO1-tpd52 Fig. 4 from Kang et al., 2020
Phenotype of all Fish created by or utilizing MO1-tpd52
Phenotype Fish Conditions Figures
neutrophil decreased amount, abnormal AB + MO1-tpd52 control Fig. 3 from Kang et al., 2020
whole organism tpd52 expression decreased amount, abnormal AB + MO1-tpd52 control Fig. 2 from Kang et al., 2020
whole organism itga2b expression decreased amount, abnormal AB + MO1-tpd52 control Fig. 4 from Kang et al., 2020
whole organism mpx expression decreased amount, abnormal AB + MO1-tpd52 control Fig. 3 from Kang et al., 2020
caudal hematopoietic tissue cell population proliferation decreased process quality, abnormal AB + MO1-tpd52 control Fig. 5 from Kang et al., 2020
dorsal aorta hematopoietic stem cell runx1 expression decreased distribution, abnormal AB + MO1-tpd52 control Fig. 4 from Kang et al., 2020
caudal hematopoietic tissue hematopoietic stem cell myb expression decreased distribution, abnormal AB + MO1-tpd52 control Fig. 4 from Kang et al., 2020
whole organism lcp1 expression decreased amount, abnormal AB + MO1-tpd52 control Fig. 3 from Kang et al., 2020
caudal hematopoietic tissue hematopoietic stem cell EGFP expression decreased distribution, abnormal la2Tg + MO1-tpd52 (AB) control Fig. 4 from Kang et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.