Morpholino

MO1-adcy9

ID
ZDB-MRPHLNO-201119-2
Name
MO1-adcy9
Previous Names
  • adcy9-e3i3-MO (1)
Target
Sequence
5' - TAGTTTGGTTCATCATGTACCTTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adcy9
Expressed Gene Anatomy Figures
badb Fig. 3 with image from Wu et al., 2020
baxa Fig. 3 with image from Wu et al., 2020
baxb Fig. 3 with image from Wu et al., 2020
bbc3 Fig. 3 with image from Wu et al., 2020
casp3a Fig. 3 with image from Wu et al., 2020
casp8 Fig. 3 with image from Wu et al., 2020
caspa Fig. 3 with image from Wu et al., 2020
hdr Fig. 3 with image from Wu et al., 2020
mmp9 Fig. 2 with image from Wu et al., 2020
pik3r2 Fig. 2 with image from Wu et al., 2020
pmaip1 Fig. 3 with image from Wu et al., 2020
ptprb Fig. 2 with image from Wu et al., 2020
tnfrsfa Fig. 3 with image from Wu et al., 2020
tnfsf10l3 Fig. 3 with image from Wu et al., 2020
tp53 Fig. 3 with image from Wu et al., 2020
Phenotype
Phenotype resulting from MO1-adcy9
Phenotype Fish Figures
atrium congested, abnormal AB + MO1-adcy9 text only from Wu et al., 2020
cardiac ventricle decreased size, abnormal AB + MO1-adcy9 text only from Wu et al., 2020
heart apoptotic, abnormal AB + MO1-adcy9 Fig. 3 with image from Wu et al., 2020
heart hypertrophic, abnormal AB + MO1-adcy9 text only from Wu et al., 2020
heart macrophage chemotaxis increased occurrence, abnormal rj1Tg + MO1-adcy9 Fig. 2 with image from Wu et al., 2020
heart contraction decreased rate, abnormal AB + MO1-adcy9 text only from Wu et al., 2020
pericardium edematous, abnormal AB + MO1-adcy9 Fig. 1 with image,  text only from Wu et al., 2020
whole organism hdr expression decreased amount, abnormal AB + MO1-adcy9 Fig. 3 with image from Wu et al., 2020
whole organism caspa expression decreased amount, abnormal AB + MO1-adcy9 Fig. 3 with image from Wu et al., 2020
whole organism decreased life span, abnormal AB + MO1-adcy9 Fig. 1 with image from Wu et al., 2020
whole organism baxa expression increased amount, abnormal AB + MO1-adcy9 Fig. 3 with image from Wu et al., 2020
whole organism mmp9 expression increased amount, abnormal AB + MO1-adcy9 Fig. 2 with image from Wu et al., 2020
whole organism viability, abnormal AB + MO1-adcy9 Fig. 1 with image from Wu et al., 2020
Phenotype of all Fish created by or utilizing MO1-adcy9
Phenotype Fish Conditions Figures
cardiac ventricle decreased size, abnormal AB + MO1-adcy9 standard conditions text only from Wu et al., 2020
whole organism baxa expression increased amount, abnormal AB + MO1-adcy9 standard conditions Fig. 3 with image from Wu et al., 2020
pericardium edematous, abnormal AB + MO1-adcy9 standard conditions Fig. 1 with image,  text only from Wu et al., 2020
whole organism caspa expression decreased amount, abnormal AB + MO1-adcy9 standard conditions Fig. 3 with image from Wu et al., 2020
whole organism viability, abnormal AB + MO1-adcy9 standard conditions Fig. 1 with image from Wu et al., 2020
whole organism hdr expression decreased amount, abnormal AB + MO1-adcy9 standard conditions Fig. 3 with image from Wu et al., 2020
atrium congested, abnormal AB + MO1-adcy9 standard conditions text only from Wu et al., 2020
heart hypertrophic, abnormal AB + MO1-adcy9 standard conditions text only from Wu et al., 2020
heart apoptotic, abnormal AB + MO1-adcy9 standard conditions Fig. 3 with image from Wu et al., 2020
whole organism mmp9 expression increased amount, abnormal AB + MO1-adcy9 standard conditions Fig. 2 with image from Wu et al., 2020
whole organism decreased life span, abnormal AB + MO1-adcy9 standard conditions Fig. 1 with image from Wu et al., 2020
heart contraction decreased rate, abnormal AB + MO1-adcy9 standard conditions text only from Wu et al., 2020
heart macrophage chemotaxis increased occurrence, abnormal rj1Tg + MO1-adcy9 standard conditions Fig. 2 with image from Wu et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.