Morpholino

MO5-kdm6bb

ID
ZDB-MRPHLNO-180706-1
Name
MO5-kdm6bb
Previous Names
None
Target
Sequence
5' - CCCATCTCGCTGTTACTGTGTTTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-kdm6bb
Expressed Gene Anatomy Figures
gata1a Fig. 3 from Yu et al., 2018
hbae1.1 Fig. 3 from Yu et al., 2018
hbbe3 Fig. 3 from Yu et al., 2018
lyz Fig. 5 from Yu et al., 2018
mpx Fig. 5 from Yu et al., 2018
spi1b Fig. 3,  Fig. 5 from Yu et al., 2018
Phenotype
Phenotype resulting from MO5-kdm6bb
Phenotype Fish Figures
common myeloid progenitor cell proliferation disrupted, abnormal rj1Tg + MO5-kdm6bb Fig. 4 from Yu et al., 2018
common myeloid progenitor cell proliferation process quality, abnormal WT + MO5-kdm6bb Fig. 3 from Yu et al., 2018
definitive hemopoiesis disrupted, abnormal WT + MO5-kdm6bb Fig. S4 from Yu et al., 2018
intermediate cell mass of mesoderm spi1b expression decreased amount, abnormal WT + MO5-kdm6bb Fig. 3 from Yu et al., 2018
intermediate cell mass of mesoderm gata1a expression increased amount, abnormal WT + MO5-kdm6bb Fig. 3 from Yu et al., 2018
intermediate cell mass of mesoderm hbae1.1 expression increased amount, abnormal WT + MO5-kdm6bb Fig. 3 from Yu et al., 2018
intermediate cell mass of mesoderm hbbe3 expression increased amount, abnormal WT + MO5-kdm6bb Fig. 3 from Yu et al., 2018
myeloid cell apoptotic process increased occurrence, abnormal rj1Tg + MO5-kdm6bb Fig. 4 from Yu et al., 2018
myeloid cell differentiation disrupted, abnormal WT + MO5-kdm6bb Fig. 5 from Yu et al., 2018
primitive hemopoiesis disrupted, abnormal WT + MO5-kdm6bb Fig. S4 from Yu et al., 2018
whole organism hbbe3 expression increased amount, abnormal WT + MO5-kdm6bb Fig. 3 from Yu et al., 2018
whole organism gata1a expression increased amount, abnormal WT + MO5-kdm6bb Fig. 3 from Yu et al., 2018
whole organism hbae1.1 expression increased amount, abnormal WT + MO5-kdm6bb Fig. 3 from Yu et al., 2018
whole organism cell EGFP expression decreased amount, abnormal rj1Tg + MO5-kdm6bb Fig. S4 from Yu et al., 2018
whole organism cell lyz expression decreased amount, abnormal WT + MO5-kdm6bb Fig. 5 from Yu et al., 2018
whole organism cell mpx expression decreased amount, abnormal WT + MO5-kdm6bb Fig. 5 from Yu et al., 2018
whole organism cell spi1b expression decreased amount, abnormal WT + MO5-kdm6bb Fig. 5 from Yu et al., 2018
whole organism common myeloid progenitor spi1b expression decreased amount, abnormal WT + MO5-kdm6bb Fig. 3 from Yu et al., 2018
Phenotype of all Fish created by or utilizing MO5-kdm6bb
Phenotype Fish Conditions Figures
whole organism cell spi1b expression decreased amount, abnormal WT + MO5-kdm6bb standard conditions Fig. 5 from Yu et al., 2018
intermediate cell mass of mesoderm hbae1.1 expression increased amount, abnormal WT + MO5-kdm6bb standard conditions Fig. 3 from Yu et al., 2018
whole organism hbae1.1 expression increased amount, abnormal WT + MO5-kdm6bb standard conditions Fig. 3 from Yu et al., 2018
whole organism gata1a expression increased amount, abnormal WT + MO5-kdm6bb standard conditions Fig. 3 from Yu et al., 2018
intermediate cell mass of mesoderm gata1a expression increased amount, abnormal WT + MO5-kdm6bb standard conditions Fig. 3 from Yu et al., 2018
whole organism cell mpx expression decreased amount, abnormal WT + MO5-kdm6bb standard conditions Fig. 5 from Yu et al., 2018
intermediate cell mass of mesoderm spi1b expression decreased amount, abnormal WT + MO5-kdm6bb standard conditions Fig. 3 from Yu et al., 2018
primitive hemopoiesis disrupted, abnormal WT + MO5-kdm6bb standard conditions Fig. S4 from Yu et al., 2018
whole organism common myeloid progenitor spi1b expression decreased amount, abnormal WT + MO5-kdm6bb standard conditions Fig. 3 from Yu et al., 2018
myeloid cell differentiation disrupted, abnormal WT + MO5-kdm6bb standard conditions Fig. 5 from Yu et al., 2018
common myeloid progenitor cell proliferation process quality, abnormal WT + MO5-kdm6bb standard conditions Fig. 3 from Yu et al., 2018
definitive hemopoiesis disrupted, abnormal WT + MO5-kdm6bb standard conditions Fig. S4 from Yu et al., 2018
intermediate cell mass of mesoderm hbbe3 expression increased amount, abnormal WT + MO5-kdm6bb standard conditions Fig. 3 from Yu et al., 2018
whole organism cell lyz expression decreased amount, abnormal WT + MO5-kdm6bb standard conditions Fig. 5 from Yu et al., 2018
whole organism hbbe3 expression increased amount, abnormal WT + MO5-kdm6bb standard conditions Fig. 3 from Yu et al., 2018
whole organism cell EGFP expression decreased amount, abnormal rj1Tg + MO5-kdm6bb standard conditions Fig. S4 from Yu et al., 2018
myeloid cell apoptotic process increased occurrence, abnormal rj1Tg + MO5-kdm6bb standard conditions Fig. 4 from Yu et al., 2018
common myeloid progenitor cell proliferation disrupted, abnormal rj1Tg + MO5-kdm6bb standard conditions Fig. 4 from Yu et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.