Morpholino

MO2-linc-tr

ID

ZDB-MRPHLNO-180305-3

Name

MO2-linc-tr

Previous Names

TRMO2 (1)

Target

linc-tr (1)

Sequence

5' - TCAAGTTAATCTGCTCAGTGTTGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-linc-tr

Expressed Gene	Anatomy	Figures
csf3r	intermediate cell mass of mesoderm myeloid cell	Fig. 4 from Alcaraz-Pérez et al., 2014
gata1a	intermediate cell mass of mesoderm nucleate erythrocyte	Fig. 4 from Alcaraz-Pérez et al., 2014
lmo2	intermediate cell mass of mesoderm	Fig. 4 from Alcaraz-Pérez et al., 2014
myb	ventral wall of dorsal aorta	Fig. 4 from Alcaraz-Pérez et al., 2014
rag1	common lymphoid progenitor	Fig. 4 from Alcaraz-Pérez et al., 2014
runx1	ventral wall of dorsal aorta	Fig. 4 from Alcaraz-Pérez et al., 2014
spi1b	intermediate cell mass of mesoderm myeloid cell	Fig. 4 from Alcaraz-Pérez et al., 2014

Phenotype

Phenotype resulting from MO2-linc-tr

Phenotype	Fish	Figures
blood cell morphology, abnormal	WT + MO2-linc-tr	Fig. 5S from Alcaraz-Pérez et al., 2014
cell chromosome, telomeric region decreased length, abnormal	WT + MO2-linc-tr	Fig. 3 from Alcaraz-Pérez et al., 2014
intermediate cell mass of mesoderm spi1b expression decreased amount, abnormal	WT + MO2-linc-tr	Fig. 4 from Alcaraz-Pérez et al., 2014
intermediate cell mass of mesoderm csf3r expression decreased amount, abnormal	WT + MO2-linc-tr	Fig. 4 from Alcaraz-Pérez et al., 2014
macrophage decreased amount, abnormal	gl23Tg + MO2-linc-tr	Fig. 2 from Alcaraz-Pérez et al., 2014
myeloid cell spi1b expression decreased amount, abnormal	WT + MO2-linc-tr	Fig. 4 from Alcaraz-Pérez et al., 2014
myeloid cell csf3r expression decreased amount, abnormal	WT + MO2-linc-tr	Fig. 4 from Alcaraz-Pérez et al., 2014
neutrophil decreased amount, abnormal	nz50Tg + MO2-linc-tr	Fig. 2, Fig. 4 from Alcaraz-Pérez et al., 2014
nucleate erythrocyte radius, abnormal	WT + MO2-linc-tr	Fig. 5S from Alcaraz-Pérez et al., 2014
telomerase activity decreased process quality, abnormal	WT + MO2-linc-tr	Fig. 1 from Alcaraz-Pérez et al., 2014

Phenotype of all Fish created by or utilizing MO2-linc-tr

Phenotype	Fish	Conditions	Figures
blood cell morphology, abnormal	WT + MO2-linc-tr	standard conditions	Fig. 5S from Alcaraz-Pérez et al., 2014
myeloid cell spi1b expression decreased amount, abnormal	WT + MO2-linc-tr	standard conditions	Fig. 4 from Alcaraz-Pérez et al., 2014
intermediate cell mass of mesoderm csf3r expression decreased amount, abnormal	WT + MO2-linc-tr	standard conditions	Fig. 4 from Alcaraz-Pérez et al., 2014
nucleate erythrocyte radius, abnormal	WT + MO2-linc-tr	standard conditions	Fig. 5S from Alcaraz-Pérez et al., 2014
intermediate cell mass of mesoderm spi1b expression decreased amount, abnormal	WT + MO2-linc-tr	standard conditions	Fig. 4 from Alcaraz-Pérez et al., 2014
telomerase activity decreased process quality, abnormal	WT + MO2-linc-tr	standard conditions	Fig. 1 from Alcaraz-Pérez et al., 2014
myeloid cell csf3r expression decreased amount, abnormal	WT + MO2-linc-tr	standard conditions	Fig. 4 from Alcaraz-Pérez et al., 2014
neutrophil decreased amount, abnormal	WT + MO2-linc-tr	standard conditions	Fig. 4 from Alcaraz-Pérez et al., 2014
cell chromosome, telomeric region decreased length, abnormal	WT + MO2-linc-tr	standard conditions	Fig. 3 from Alcaraz-Pérez et al., 2014
macrophage decreased amount, abnormal	gl23Tg + MO2-linc-tr	standard conditions	Fig. 2 from Alcaraz-Pérez et al., 2014
neutrophil decreased amount, abnormal	nz50Tg + MO2-linc-tr	standard conditions	Fig. 2 from Alcaraz-Pérez et al., 2014
neutrophil decreased amount, abnormal	tert^{hu3430/hu3430} + MO2-linc-tr	standard conditions	Fig. 3 from Alcaraz-Pérez et al., 2014
cell chromosome, telomeric region decreased length, abnormal	tert^{hu3430/hu3430} + MO2-linc-tr	standard conditions	Fig. 3 from Alcaraz-Pérez et al., 2014

Citations