Morpholino

MO1-polr3h

ID
ZDB-MRPHLNO-160811-2
Name
MO1-polr3h
Previous Names
None
Target
Sequence
5' - CACCAGCACAAACATCCCGAGCAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-polr3h
Expressed Gene Anatomy Figures
gata1a Fig. 5 with image from Wei et al., 2016
myb Fig. 5 with image from Wei et al., 2016
rag1 Fig. 5 with image from Wei et al., 2016
spi1b Fig. 5 with image from Wei et al., 2016
Phenotype
Phenotype resulting from MO1-polr3h
Phenotype Fish Figures
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal AB + MO1-polr3h Fig. 5 with image from Wei et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal AB + MO1-polr3h Fig. 5 with image from Wei et al., 2016
hematopoietic system posterior region myb expression decreased amount, abnormal AB + MO1-polr3h Fig. 5 with image from Wei et al., 2016
hematopoietic system posterior region gata1a expression decreased amount, abnormal AB + MO1-polr3h Fig. 5 with image from Wei et al., 2016
hematopoietic system posterior region spi1b expression decreased amount, abnormal AB + MO1-polr3h Fig. 5 with image from Wei et al., 2016
thymus rag1 expression absent, abnormal AB + MO1-polr3h Fig. 5 with image from Wei et al., 2016
thymus T cell absent, abnormal AB + MO1-polr3h Fig. 5 with image from Wei et al., 2016
whole organism gata1a expression decreased amount, abnormal AB + MO1-polr3h Fig. 5 with image from Wei et al., 2016
whole organism spi1b expression decreased amount, abnormal AB + MO1-polr3h Fig. 5 with image from Wei et al., 2016
whole organism myb expression decreased amount, abnormal AB + MO1-polr3h Fig. 5 with image from Wei et al., 2016
Phenotype of all Fish created by or utilizing MO1-polr3h
Phenotype Fish Conditions Figures
hematopoietic system posterior region gata1a expression decreased amount, abnormal AB + MO1-polr3h standard conditions Fig. 5 with image from Wei et al., 2016
whole organism spi1b expression decreased amount, abnormal AB + MO1-polr3h standard conditions Fig. 5 with image from Wei et al., 2016
whole organism myb expression decreased amount, abnormal AB + MO1-polr3h standard conditions Fig. 5 with image from Wei et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal AB + MO1-polr3h standard conditions Fig. 5 with image from Wei et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal AB + MO1-polr3h standard conditions Fig. 5 with image from Wei et al., 2016
thymus T cell absent, abnormal AB + MO1-polr3h standard conditions Fig. 5 with image from Wei et al., 2016
hematopoietic system posterior region spi1b expression decreased amount, abnormal AB + MO1-polr3h standard conditions Fig. 5 with image from Wei et al., 2016
thymus rag1 expression absent, abnormal AB + MO1-polr3h standard conditions Fig. 5 with image from Wei et al., 2016
whole organism gata1a expression decreased amount, abnormal AB + MO1-polr3h standard conditions Fig. 5 with image from Wei et al., 2016
hematopoietic system posterior region myb expression decreased amount, abnormal AB + MO1-polr3h standard conditions Fig. 5 with image from Wei et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.