Morpholino

MO2-mecp2

ID
ZDB-MRPHLNO-150925-1
Name
MO2-mecp2
Previous Names
None
Target
Sequence
5' - TCTGCGGCGGCCATTTTTATTTAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mecp2
Expressed Gene Anatomy Figures
dla Fig. 3 with image from Gao et al., 2015
dlb Fig. 3 with image from Gao et al., 2015
dlc Fig. 3 with image from Gao et al., 2015
elavl3 Fig. 2 with image,  Fig. 4 with image,  Fig. 6 with image from Gao et al., 2015
gfap Fig. 2 with image,  Fig. 3 with image from Gao et al., 2015
her2 Fig. 3 with image,  Fig. 5 with image from Gao et al., 2015
her4.1 Fig. 3 with image from Gao et al., 2015
id1 Fig. 5 with image from Gao et al., 2015
isl1a Fig. 2 with image from Gao et al., 2015
map2 Fig. 2 with image,  Fig. 3 with image from Gao et al., 2015
mecp2 Fig. 1 with image from Gao et al., 2015
nes Fig. 2 with image,  Fig. 3 with image from Gao et al., 2015
neurod1 Fig. 2 with image,  Fig. 4 with image from Gao et al., 2015
notch1a Fig. 3 with image from Gao et al., 2015
notch1b Fig. 3 with image from Gao et al., 2015
Phenotype
Phenotype resulting from MO2-mecp2
Phenotype Fish Figures
brain has extra parts of type astrocyte, abnormal WT + MO2-mecp2 Fig. 2 with image,  Fig. 3 with image from Gao et al., 2015
brain has extra parts of type neuronal stem cell, abnormal WT + MO2-mecp2 Fig. 2 with image,  Fig. 3 with image from Gao et al., 2015
brain has fewer parts of type neuron, abnormal WT + MO2-mecp2 Fig. 2 with image,  Fig. 3 with image from Gao et al., 2015
brain astrocyte differentiation increased occurrence, abnormal WT + MO2-mecp2 Fig. 2 with image from Gao et al., 2015
brain neural precursor cell proliferation increased occurrence, abnormal WT + MO2-mecp2 Fig. 2 with image,  Fig. 3 with image,  Fig. 6 with image from Gao et al., 2015
brain neuron differentiation decreased occurrence, abnormal rw0Tg + MO2-mecp2 Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Gao et al., 2015
brain neuronal stem cell proliferative, abnormal WT + MO2-mecp2 Fig. 2 with image,  Fig. 3 with image from Gao et al., 2015
brain Notch signaling pathway increased occurrence, abnormal WT + MO2-mecp2 Fig. 3 with image from Gao et al., 2015
facial ganglion has fewer parts of type motor neuron, abnormal rw0Tg + MO2-mecp2 Fig. 2 with image from Gao et al., 2015
trigeminal ganglion has fewer parts of type motor neuron, abnormal rw0Tg + MO2-mecp2 Fig. 2 with image from Gao et al., 2015
vagal ganglion has fewer parts of type motor neuron, abnormal rw0Tg + MO2-mecp2 Fig. 2 with image from Gao et al., 2015
Phenotype of all Fish created by or utilizing MO2-mecp2
Phenotype Fish Conditions Figures
brain Notch signaling pathway increased occurrence, abnormal WT + MO2-mecp2 standard conditions Fig. 3 with image from Gao et al., 2015
brain has fewer parts of type neuron, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with image,  Fig. 3 with image from Gao et al., 2015
brain neuron differentiation decreased occurrence, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Gao et al., 2015
brain has extra parts of type neuronal stem cell, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with image,  Fig. 3 with image from Gao et al., 2015
brain neuronal stem cell proliferative, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with image,  Fig. 3 with image from Gao et al., 2015
brain astrocyte differentiation increased occurrence, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
brain has extra parts of type astrocyte, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with image,  Fig. 3 with image from Gao et al., 2015
brain neural precursor cell proliferation increased occurrence, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 6 with image from Gao et al., 2015
brain has fewer parts of type neuron, abnormal nl1Tg + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
brain neuron differentiation decreased occurrence, abnormal nl1Tg + MO2-mecp2 standard conditions Fig. 2 with image,  Fig. 4 with image,  Fig. 6 with image from Gao et al., 2015
trigeminal ganglion has fewer parts of type motor neuron, abnormal rw0Tg + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
facial ganglion has fewer parts of type motor neuron, abnormal rw0Tg + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
brain neuron differentiation decreased occurrence, abnormal rw0Tg + MO2-mecp2 standard conditions Fig. 2 with image,  Fig. 4 with image,  Fig. 6 with image from Gao et al., 2015
vagal ganglion has fewer parts of type motor neuron, abnormal rw0Tg + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
brain neuronal stem cell proliferative, abnormal pku322Tg + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
brain neural precursor cell proliferation increased occurrence, abnormal pku322Tg + MO2-mecp2 standard conditions Fig. 2 with image,  Fig. 6 with image from Gao et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.