Morpholino
MO1-scarna1
- ID
- ZDB-MRPHLNO-150916-3
- Name
- MO1-scarna1
- Previous Names
- None
- Target
- Sequence
-
5' - CTAGATGGCAGTCCTGATGTGCCCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-scarna1
Expressed Gene | Anatomy | Figures |
---|---|---|
dot1l |
Fig. 8
from Patil et al., 2015 |
|
fzd3b |
Fig. 8
from Patil et al., 2015 |
|
gata4 |
Fig. 7
from Patil et al., 2015 |
|
kctd15a |
Fig. 8
from Patil et al., 2015 |
|
mbnl1 |
Fig. 7
from Patil et al., 2015 |
|
mllt10 |
Fig. 8
from Patil et al., 2015 |
|
sfrp1a |
Fig. 8
from Patil et al., 2015 |
|
vangl2 |
Fig. 8
from Patil et al., 2015 |
|
wnt4 |
Fig. 8
from Patil et al., 2015 |
|
wnt4b |
Fig. 8
from Patil et al., 2015 |
|
wnt8a |
Fig. 8
from Patil et al., 2015 |
|
wnt8b |
Fig. 8
from Patil et al., 2015 |
|
wnt10a |
Fig. 8
from Patil et al., 2015 |
|
wnt10b |
Fig. 8
from Patil et al., 2015 |
Phenotype
Phenotype resulting from MO1-scarna1
Phenotype of all Fish created by or utilizing MO1-scarna1
Citations