Morpholino
MO3-mir142
- ID
- ZDB-MRPHLNO-141229-2
- Name
- MO3-mir142
- Previous Names
-
- miR-142a-3p MO1 (1)
- Targets
- Sequence
-
5' - TCCATAAAGTAGGAAACACTACACT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mir142
Expressed Gene | Anatomy | Figures |
---|---|---|
csf3r |
Fig. 6
from Lu et al., 2013 |
|
dlc |
Fig. 3
from Lu et al., 2013 |
|
flt4 |
Fig. 3
from Lu et al., 2013 |
|
foxn1 |
Fig. 2
from Lu et al., 2013 |
|
foxp1a |
Fig. S4
from Lu et al., 2013 |
1 - 5 of 12 Show all
Phenotype
Phenotype resulting from MO3-mir142
No data available
Phenotype of all Fish created by or utilizing MO3-mir142
1 - 5 of 5
Citations
- Fan, H.B., Liu, Y.J., Wang, L., Du, T.T., Dong, M., Gao, L., Meng, Z.Z., Jin, Y., Chen, Y., Deng, M., Yang, H.T., Jing, Q., Gu, A.H., Liu, T.X., Zhou, Y. (2014) miR-142-3p acts as an essential modulator of neutrophil development in zebrafish. Blood. 124(8):1320-30
- Song, B., Zhang, Q., Zhang, Z., Wan, Y., Jia, Q., Wang, X., Zhu, X., Leung, A.Y., Cheng, T., Fang, X., Yuan, W., Jia, H. (2014) Systematic transcriptome analysis of the zebrafish model of diamond-blackfan anemia induced by RPS24 deficiency. BMC Genomics. 15:759
- Lu, X., Li, X., He, Q., Gao, J., Gao, Y., Liu, B., and Liu, F. (2013) miR-142-3p regulates the formation and differentiation of hematopoietic stem cells in vertebrates. Cell Research. 23(12):1356-68
1 - 3 of 3
Show