Morpholino
MO1-smarca2
- ID
- ZDB-MRPHLNO-141205-14
- Name
- MO1-smarca2
- Previous Names
- None
- Target
- Sequence
-
5' - GGCCATCTATCAGATGAGAATCTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smarca2
Expressed Gene | Anatomy | Figures |
---|---|---|
myb |
Fig. 2
from Ding et al., 2020 |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-smarca2
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-smarca2
1 - 3 of 3
Citations
- Ma, J., Gu, Y., Liu, J., Song, J., Zhou, T., Jiang, M., Wen, Y., Guo, X., Zhou, Z., Sha, J., He, J., Hu, Z., Luo, L., Liu, M. (2022) Functional screening of congenital heart disease risk loci identifies 5 genes essential for heart development in zebrafish. Cellular and molecular life sciences : CMLS. 80:1919
- Ding, Y., Wang, W., Ma, D., Liang, G., Kang, Z., Xue, Y., Zhang, Y., Wang, L., Heng, J., Zhang, Y., Liu, F. (2020) Smarca5 mediated epigenetic programming facilitates fetal HSPC development in vertebrates. Blood. 137(2):190-202
- Laue, K., Rajshekar, S., Courtney, A.J., Lewis, Z.A., Goll, M.G. (2019) The maternal to zygotic transition regulates genome-wide heterochromatin establishment in the zebrafish embryo. Nature communications. 10:1551
- Huang, H.T., Kathrein, K.L., Barton, A., Gitlin, Z., Huang, Y.H., Ward, T.P., Hofmann, O., Dibiase, A., Song, A., Tyekucheva, S., Hide, W., Zhou, Y., and Zon, L.I. (2013) A network of epigenetic regulators guides developmental haematopoiesis in vivo. Nature cell biology. 15(12):1516-1525
1 - 4 of 4
Show