Morpholino

MO2-vsx1

ID
ZDB-MRPHLNO-140307-1
Name
MO2-vsx1
Previous Names
None
Target
Sequence
5' - TGTAGCTTCTTCTCTTCCCGTCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-vsx1
Expressed Gene Anatomy Figures
bmp2b Fig. 6 with image from He et al., 2014
ctslb Fig. 1 with image,  Fig. 5 with image from Xu et al., 2014
dkk1b Fig. 6 with image from Xu et al., 2014
dlx3b Fig. 1 with image from Xu et al., 2014
egr2b Fig. 4 with image from Xu et al., 2014
en2a Fig. 4 with image from Xu et al., 2014
gsc Fig. 2 with image,  Fig. 6 with image from Xu et al., 2014
hoxb1b Fig. 4 with image from Xu et al., 2014
msgn1 Fig. 3 with image from He et al., 2014
myod1 Fig. 2 with image from He et al., 2014
noto Fig. 5 with image from He et al., 2014
otx2b Fig. 6 with image from Xu et al., 2014
pax2a Fig. 4 with image from Xu et al., 2014
pcdh8 Fig. 5 with image from He et al., 2014
rx3 Fig. 4 with image,  Fig. 5 with image from Xu et al., 2014
six3b Fig. 4 with image,  Fig. 6 with image from Xu et al., 2014
tbx6 Fig. 3 with image from He et al., 2014
tbx16 Fig. 5 with image from He et al., 2014
tbxta Fig. 2 with image from He et al., 2014
Fig. 1 with image,  Fig. 2 with image,  Fig. 7 with image from Xu et al., 2014
vent Fig. 6 with image from He et al., 2014
vox Fig. 6 with image from He et al., 2014
vsx1 Fig. 4 with image from He et al., 2014
wnt8a Fig. 6 with image from He et al., 2014
Phenotype
Phenotype resulting from MO2-vsx1
Phenotype Fish Figures
anatomical structure dorso-medial region disorganized, abnormal WT + MO2-vsx1 Fig. 1 with image from He et al., 2014
axial mesoderm formation process quality, abnormal WT + MO2-vsx1 Fig. 2 with image from He et al., 2014
brain morphology, abnormal WT + MO2-vsx1 Fig. 3 with image from Xu et al., 2014
forebrain development process quality, abnormal WT + MO2-vsx1 Fig. 4 with image,  Fig. 5 with image from Xu et al., 2014
paraxial mesoderm formation process quality, abnormal WT + MO2-vsx1 Fig. 2 with image from He et al., 2014
prechordal plate mesodermal cell migration process quality, abnormal WT + MO2-vsx1 Fig. 2 with image from Xu et al., 2014
prechordal plate formation process quality, abnormal WT + MO2-vsx1 Fig. 1 with image,  Fig. 2 with image,  Fig. 5 with image from Xu et al., 2014
somite absent, abnormal WT + MO2-vsx1 Fig. 1 with image from He et al., 2014
spinal cord bifurcated, abnormal WT + MO2-vsx1 Fig. 1 with image from He et al., 2014
ventricular system morphology, abnormal WT + MO2-vsx1 Fig. 3 with image from Xu et al., 2014
whole organism decreased life span, abnormal WT + MO2-vsx1 Fig. 1 with image from He et al., 2014
whole organism wholly dorsalized, abnormal WT + MO2-vsx1 Fig. 1 with image from He et al., 2014
Fig. 3 with image from Xu et al., 2014
Phenotype of all Fish created by or utilizing MO2-vsx1
Phenotype Fish Conditions Figures
prechordal plate mesodermal cell migration process quality, abnormal WT + MO2-vsx1 standard conditions Fig. 2 with image from Xu et al., 2014
axial mesoderm formation process quality, abnormal WT + MO2-vsx1 standard conditions Fig. 2 with image from He et al., 2014
somite absent, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with image from He et al., 2014
whole organism decreased life span, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with image from He et al., 2014
paraxial mesoderm formation process quality, abnormal WT + MO2-vsx1 standard conditions Fig. 2 with image from He et al., 2014
ventricular system morphology, abnormal WT + MO2-vsx1 standard conditions Fig. 3 with image from Xu et al., 2014
brain morphology, abnormal WT + MO2-vsx1 standard conditions Fig. 3 with image from Xu et al., 2014
prechordal plate formation process quality, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 5 with image from Xu et al., 2014
spinal cord bifurcated, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with image from He et al., 2014
forebrain development process quality, abnormal WT + MO2-vsx1 standard conditions Fig. 4 with image,  Fig. 5 with image from Xu et al., 2014
anatomical structure dorso-medial region disorganized, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with image from He et al., 2014
whole organism wholly dorsalized, abnormal WT + MO2-vsx1 standard conditions Fig. 1 with image from He et al., 2014
Fig. 3 with image from Xu et al., 2014
notochord morphology, abnormal WT + MO2-vsx1 + MO4-tbxta standard conditions Fig. 3 with image from Xu et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.