Morpholino

MO1-hspb7

ID

ZDB-MRPHLNO-131119-2

Name

MO1-hspb7

Previous Names

7MO (1)
Splice acceptor site of intron 1. (1)

Target

hspb7 (1)

Sequence

5' - CCTGTTCTGTCTGATGAAAAACATA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hspb7

Expressed Gene	Anatomy	Figures
lft1	heart rudiment	Fig. 6 from Rosenfeld et al., 2013
lft2	heart rudiment	Fig. 6 from Rosenfeld et al., 2013
myh6	atrial myocardium cardiac muscle cell	Fig. 3 from Rosenfeld et al., 2013
spaw	heart primordium	Fig. 6 from Rosenfeld et al., 2013

Phenotype

Phenotype resulting from MO1-hspb7

Phenotype	Fish	Figures
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-hspb7	Fig. 6 from Rosenfeld et al., 2013
embryonic heart tube formation disrupted, abnormal	twu34Tg + MO1-hspb7	Fig. 7 from Rosenfeld et al., 2013
heart morphology, abnormal	twu34Tg + MO1-hspb7	Fig. 2 , Fig. 3 from Rosenfeld et al., 2013
heart development disrupted, abnormal	twu34Tg + MO1-hspb7	Fig. 12 from Mercer et al., 2018
heart jogging disrupted, abnormal	twu34Tg + MO1-hspb7	Fig. 5 from Rosenfeld et al., 2013
heart looping disrupted, abnormal	twu34Tg + MO1-hspb7	Fig. 2 from Rosenfeld et al., 2013
Kupffer's vesicle decreased width, abnormal	s870Tg + MO1-hspb7	Fig. 8 from Rosenfeld et al., 2013
Kupffer's vesicle functionality, abnormal	WT + MO1-hspb7	Fig. 9 from Rosenfeld et al., 2013
Kupffer's vesicle ciliated cell decreased amount, abnormal	s870Tg + MO1-hspb7	Fig. 8 from Rosenfeld et al., 2013
Kupffer's vesicle ciliated cell decreased length, abnormal	s870Tg + MO1-hspb7	Fig. 8 from Rosenfeld et al., 2013

Phenotype of all Fish created by or utilizing MO1-hspb7

Phenotype	Fish	Conditions	Figures
Kupffer's vesicle functionality, abnormal	WT + MO1-hspb7	standard conditions	Fig. 9 from Rosenfeld et al., 2013
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-hspb7	standard conditions	Fig. 6 from Rosenfeld et al., 2013
Kupffer's vesicle decreased width, abnormal	s870Tg + MO1-hspb7	standard conditions	Fig. 8 from Rosenfeld et al., 2013
Kupffer's vesicle ciliated cell decreased length, abnormal	s870Tg + MO1-hspb7	standard conditions	Fig. 8 from Rosenfeld et al., 2013
Kupffer's vesicle ciliated cell decreased amount, abnormal	s870Tg + MO1-hspb7	standard conditions	Fig. 8 from Rosenfeld et al., 2013
heart looping disrupted, abnormal	twu34Tg + MO1-hspb7	standard conditions	Fig. 2 from Rosenfeld et al., 2013
heart morphology, abnormal	twu34Tg + MO1-hspb7	standard conditions	Fig. 2 from Rosenfeld et al., 2013
heart development disrupted, abnormal	twu34Tg + MO1-hspb7	standard conditions	Fig. 12 from Mercer et al., 2018
embryonic heart tube formation disrupted, abnormal	twu34Tg + MO1-hspb7	standard conditions	Fig. 7 from Rosenfeld et al., 2013
heart jogging disrupted, abnormal	twu34Tg + MO1-hspb7	standard conditions	Fig. 5 from Rosenfeld et al., 2013
heart morphology, abnormal	f2Tg; twu34Tg + MO1-hspb7	standard conditions	Fig. 3 from Rosenfeld et al., 2013
heart morphology, abnormal	f2Tg; twu34Tg + MO1-hspb12 + MO1-hspb7	standard conditions	Fig. 3 from Rosenfeld et al., 2013
ventricular myocardium cardiac muscle cell decreased amount, abnormal	f2Tg; twu34Tg + MO1-hspb12 + MO1-hspb7	standard conditions	Fig. 3 from Rosenfeld et al., 2013
ventricular myocardium cardiac muscle cell decreased size, abnormal	sd10Tg; sd11Tg + MO1-hspb7	standard conditions	Fig. 4 from Rosenfeld et al., 2013
ventricular myocardium cardiac muscle cell decreased size, abnormal	sd10Tg; sd11Tg + MO1-hspb12 + MO1-hspb7	standard conditions	Fig. 4 from Rosenfeld et al., 2013

Citations