Morpholino

MO1-fgf22

ID
ZDB-MRPHLNO-130911-1
Name
MO1-fgf22
Previous Names
  • fgf22 exon 2/intron 2 spliceblocking MO1 (1)
Target
Sequence
5' - ATGCGATGTACCTACCGATCCGAAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf22
Expressed Gene Anatomy Figures
bmp5 Fig. 5 with image from Miyake et al., 2013
en2a Fig. 4 with image from Miyake et al., 2013
fgf3 Fig. 8 with image from Miyake et al., 2013
fgf8a Fig. 8 with image from Miyake et al., 2013
her5 Fig. 4 with image from Miyake et al., 2013
lmx1ba Fig. 5 with image from Miyake et al., 2013
meis2a Fig. 6 with image from Miyake et al., 2013
msx1b Fig. 5 with image from Miyake et al., 2013
nkx6.2 Fig. 6 with image from Miyake et al., 2013
otx2b Fig. 6 with image from Miyake et al., 2013
pax2a Fig. 4 with image from Miyake et al., 2013
pax7a Fig. 6 with image from Miyake et al., 2013
shha Fig. 7 with image from Miyake et al., 2013
wnt1 Fig. 4 with image,  Fig. 5 with image from Miyake et al., 2013
Phenotype
Phenotype resulting from MO1-fgf22
Phenotype Fish Figures
cell proliferation in midbrain decreased occurrence, abnormal WT + MO1-fgf22 Fig. 3 with image from Miyake et al., 2013
forebrain morphology, abnormal WT + MO1-fgf22 Fig. 2 with image from Miyake et al., 2013
forebrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 Fig. 2 with image from Miyake et al., 2013
midbrain morphology, abnormal WT + MO1-fgf22 + MO4-tp53 Fig. 2 with image from Miyake et al., 2013
midbrain development disrupted, abnormal WT + MO1-fgf22 Fig. 2 with image,  Fig. 5 with image from Miyake et al., 2013
midbrain hindbrain boundary morphology, abnormal WT + MO1-fgf22 Fig. 2 with image from Miyake et al., 2013
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 Fig. 2 with image from Miyake et al., 2013
roof plate formation disrupted, abnormal WT + MO1-fgf22 Fig. 4 with image from Miyake et al., 2013
roof plate midbrain region increased width, abnormal WT + MO1-fgf22 Fig. 4 with image from Miyake et al., 2013
Phenotype of all Fish created by or utilizing MO1-fgf22
Phenotype Fish Conditions Figures
forebrain development disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
roof plate midbrain region increased width, abnormal WT + MO1-fgf22 standard conditions Fig. 4 with image from Miyake et al., 2013
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain development disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image,  Fig. 5 with image from Miyake et al., 2013
midbrain morphology, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
forebrain morphology, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
roof plate formation disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 4 with image from Miyake et al., 2013
cell proliferation in midbrain decreased occurrence, abnormal WT + MO1-fgf22 standard conditions Fig. 3 with image from Miyake et al., 2013
midbrain hindbrain boundary morphology, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
forebrain morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
forebrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain hindbrain boundary morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.