Morpholino

MO2-ptpro

ID
ZDB-MRPHLNO-130628-2
Name
MO2-ptpro
Previous Names
  • MO ATG (1)
Target
Sequence
5' - TCGCACTCTTTGATTCTCGGCGTCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ptpro
Expressed Gene Anatomy Figures
atoh1a Fig. 4 from Liao et al., 2013
dlx2a Fig. 3 from Liao et al., 2013
dusp6 Fig. 5 from Liao et al., 2013
efna5b Fig. 4 from Liao et al., 2013
elavl3 Fig. 3 from Liao et al., 2013
emx1 Fig. 3 from Liao et al., 2013
etv5b Fig. 5 from Liao et al., 2013
evx1 Fig. 4 from Liao et al., 2013
fgf8a Fig. 5 from Liao et al., 2013
gad1b Fig. 3 from Liao et al., 2013
isl1a Fig. 3 from Liao et al., 2013
neurod1 Fig. 4 from Liao et al., 2013
olig2 Fig. 3 from Liao et al., 2013
pax2a Fig. 4 from Liao et al., 2013
pvalb7 Fig. 4 from Liao et al., 2013
shha Fig. 3 from Liao et al., 2013
spry4 Fig. 5 from Liao et al., 2013
Phenotype
Phenotype resulting from MO2-ptpro
Phenotype Fish Figures
brain hydrocephalic, abnormal AB + MO2-ptpro Fig. 2 from Liao et al., 2013
cerebellum decreased size, abnormal AB + MO2-ptpro Fig. 2 from Liao et al., 2013
cerebellum development disrupted, abnormal AB + MO2-ptpro Fig. 4 from Liao et al., 2013
eye decreased size, abnormal AB + MO2-ptpro Fig. 2 from Liao et al., 2013
forebrain decreased size, abnormal AB + MO2-ptpro Fig. 2 from Liao et al., 2013
neuron fate determination disrupted, abnormal AB + MO2-ptpro Fig. 3 from Liao et al., 2013
optic tectum decreased size, abnormal AB + MO2-ptpro Fig. 2 from Liao et al., 2013
post-vent region curved, abnormal AB + MO2-ptpro Fig. 2 from Liao et al., 2013
regulation of fibroblast growth factor receptor signaling pathway disrupted, abnormal AB + MO2-ptpro Fig. 5 from Liao et al., 2013
trunk deformed, abnormal AB + MO2-ptpro Fig. 2 from Liao et al., 2013
Phenotype of all Fish created by or utilizing MO2-ptpro
Phenotype Fish Conditions Figures
regulation of fibroblast growth factor receptor signaling pathway disrupted, abnormal AB + MO2-ptpro standard conditions Fig. 5 from Liao et al., 2013
brain hydrocephalic, abnormal AB + MO2-ptpro standard conditions Fig. 2 from Liao et al., 2013
forebrain decreased size, abnormal AB + MO2-ptpro standard conditions Fig. 2 from Liao et al., 2013
cerebellum decreased size, abnormal AB + MO2-ptpro standard conditions Fig. 2 from Liao et al., 2013
cerebellum development disrupted, abnormal AB + MO2-ptpro standard conditions Fig. 4 from Liao et al., 2013
trunk deformed, abnormal AB + MO2-ptpro standard conditions Fig. 2 from Liao et al., 2013
neuron fate determination disrupted, abnormal AB + MO2-ptpro standard conditions Fig. 3 from Liao et al., 2013
eye decreased size, abnormal AB + MO2-ptpro standard conditions Fig. 2 from Liao et al., 2013
post-vent region curved, abnormal AB + MO2-ptpro standard conditions Fig. 2 from Liao et al., 2013
optic tectum decreased size, abnormal AB + MO2-ptpro standard conditions Fig. 2 from Liao et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.