Morpholino

MO1-esco2

ID
ZDB-MRPHLNO-110713-1
Name
MO1-esco2
Previous Names
  • esco2_ATG_MO (1)
Target
Sequence
5' - CTCTTTCGGGATAACATCTTCAATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-esco2
Expressed Gene Anatomy Figures
crestin Fig. S3 with image from Mönnich et al., 2011
dlx2a Fig. S3 with image from Mönnich et al., 2011
mdm2 Fig. 6 with image from Mönnich et al., 2011
myca Fig. 6 with image from Mönnich et al., 2011
runx1 Fig. S6 with image from Mönnich et al., 2011
sox10 Fig. S3 with image from Mönnich et al., 2011
tp53 Fig. 6 with image from Mönnich et al., 2011
Phenotype
Phenotype resulting from MO1-esco2
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-esco2 Fig. 2 with image,  Fig. 4 with image from Mönnich et al., 2011
basihyal cartilage deformed, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
blood circulation disrupted, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
caudal fin curved, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
cell chromosome disorganized, abnormal WT + MO1-esco2 Fig. 4 with image from Mönnich et al., 2011
cell mitotic spindle deformed, abnormal WT + MO1-esco2 Fig. 4 with image from Mönnich et al., 2011
ceratobranchial cartilage decreased length, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
ceratobranchial cartilage decreased size, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
extension decreased thickness, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
eye decreased size, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
eye hypoplastic, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
head decreased size, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
head hypoplastic, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
heart edematous, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
hypobranchial cartilage decreased thickness, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
integument decreased pigmentation, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
mandibular arch skeleton aplastic, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
mitotic cell cycle increased occurrence, abnormal WT + MO1-esco2 Fig. 4 with image from Mönnich et al., 2011
negative regulation of TOR signaling increased occurrence, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
pectoral fin decreased length, abnormal WT + MO1-esco2 Fig. 3 with image from Mönnich et al., 2011
pectoral fin deformed, abnormal WT + MO1-esco2 Fig. 3 with image from Mönnich et al., 2011
pectoral fin cell condensed, abnormal WT + MO1-esco2 Fig. 3 with image from Mönnich et al., 2011
pectoral fin cell decreased size, abnormal WT + MO1-esco2 Fig. 3 with image from Mönnich et al., 2011
pericardial cavity edematous, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
pigmentation disrupted, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
post-vent region curved dorsal, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
somite disorganized, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
whole organism decreased size, abnormal WT + MO1-esco2 Fig. 2 with image from Mönnich et al., 2011
whole organism shortened, abnormal WT + MO1-esco2 Fig. 5 with image from Xu et al., 2013
Phenotype of all Fish created by or utilizing MO1-esco2
Phenotype Fish Conditions Figures
regenerating fin sema3d expression decreased amount, abnormal C32 + MO1-esco2 amputation: fin Fig. 10 with image from Banerji et al., 2016
regenerating fin decreased length, abnormal C32 + MO1-esco2 amputation: fin Fig. 4 with image from Banerji et al., 2016
regenerating fin gja1b expression decreased amount, abnormal C32 + MO1-esco2 amputation: fin Fig. 9 with image from Banerji et al., 2016
bone growth disrupted, abnormal C32 + MO1-esco2 amputation: fin Fig. 4 with image from Banerji et al., 2016
regenerating fin cell population proliferation decreased occurrence, abnormal C32 + MO1-esco2 amputation: fin Fig. 6 with image from Banerji et al., 2016
fin regeneration disrupted, abnormal C32 + MO1-esco2 amputation: fin Fig. 4 with image from Banerji et al., 2016
regenerating fin decreased length, abnormal C32 + MO1-esco2 amputation: fin, heat shock Fig. 12 with image from Banerji et al., 2016
regenerating fin hapln1a expression decreased amount, abnormal C32 + MO1-esco2 amputation: fin Fig. 10 with image from Banerji et al., 2016
whole organism shortened, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
caudal fin curved, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
pigmentation disrupted, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
basihyal cartilage deformed, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
head hypoplastic, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
integument decreased pigmentation, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
pectoral fin decreased length, abnormal WT + MO1-esco2 standard conditions Fig. 3 with image from Mönnich et al., 2011
eye decreased size, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
cell mitotic spindle deformed, abnormal WT + MO1-esco2 standard conditions Fig. 4 with image from Mönnich et al., 2011
pectoral fin cell condensed, abnormal WT + MO1-esco2 standard conditions Fig. 3 with image from Mönnich et al., 2011
heart edematous, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
pectoral fin deformed, abnormal WT + MO1-esco2 standard conditions Fig. 3 with image from Mönnich et al., 2011
cell chromosome disorganized, abnormal WT + MO1-esco2 standard conditions Fig. 4 with image from Mönnich et al., 2011
ceratobranchial cartilage decreased length, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
pectoral fin cell decreased size, abnormal WT + MO1-esco2 standard conditions Fig. 3 with image from Mönnich et al., 2011
head decreased size, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
extension decreased thickness, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
negative regulation of TOR signaling increased occurrence, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
pericardial cavity edematous, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
post-vent region curved dorsal, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
ceratobranchial cartilage decreased size, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
apoptotic process increased occurrence, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image,  Fig. 4 with image from Mönnich et al., 2011
somite disorganized, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
blood circulation disrupted, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
mandibular arch skeleton aplastic, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
eye hypoplastic, abnormal WT + MO1-esco2 standard conditions Fig. 5 with image from Xu et al., 2013
hypobranchial cartilage decreased thickness, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
whole organism decreased size, abnormal WT + MO1-esco2 standard conditions Fig. 2 with image from Mönnich et al., 2011
mitotic cell cycle increased occurrence, abnormal WT + MO1-esco2 standard conditions Fig. 4 with image from Mönnich et al., 2011
regenerating fin caudal fin lepidotrichium decreased length, exacerbated gja1bb123/+ + MO1-esco2 amputation: caudal fin Fig. 6 from Banerji et al., 2017
regenerating fin decreased length, exacerbated gja1bb123/+ + MO1-esco2 amputation: caudal fin Fig. 6 from Banerji et al., 2017
regenerating fin length, ameliorated pd48Tg + MO1-esco2 amputation: fin, heat shock Fig. 12 with image from Banerji et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.