Morpholino
MO1-tlr4bb
- ID
- ZDB-MRPHLNO-110427-2
- Name
- MO1-tlr4bb
- Previous Names
- None
- Target
- Sequence
-
5' - AATCATCCGTTCCCCATTTGACATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tlr4bb
Expressed Gene | Anatomy | Figures |
---|---|---|
efnb2a |
Fig. S5
from He et al., 2015 |
|
foxn1 |
Fig. 2
from He et al., 2015 |
|
gata1a |
Fig. S5
from He et al., 2015 |
|
kdrl |
Fig. S5
from He et al., 2015 |
|
lcp1 |
Fig. S5
from He et al., 2015 |
1 - 5 of 8 Show all
Phenotype
Phenotype resulting from MO1-tlr4bb
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-tlr4bb
1 - 5 of 5
Citations
- He, Q., Zhang, C., Wang, L., Zhang, P., Ma, D., Lv, J., Liu, F. (2015) Inflammatory signaling regulates hematopoietic stem and progenitor cell emergence in vertebrates. Blood. 125(7):1098-106
- Sepulcre, M.P., Alcaraz-Pérez, F., López-Muñoz, A., Roca, F.J., Meseguer, J., Cayuela, M.L., and Mulero, V. (2009) Evolution of lipopolysaccharide (LPS) recognition and signaling: fish TLR4 does not recognize LPS and negatively regulates NF-kappaB activation. Journal of immunology (Baltimore, Md. : 1950). 182(4):1836-1845
1 - 2 of 2
Show