Morpholino

MO1-tomm22

ID
ZDB-MRPHLNO-100726-1
Name
MO1-tomm22
Previous Names
None
Target
Sequence
5' - GAGAAAGCTCCTGGATCGTAGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tomm22
Expressed Gene Anatomy Figures
cp Fig. 1 with image from Wu et al., 2017
fabp10a Fig. 1 with image from Wu et al., 2017
foxa3 Fig. 1 with image from Wu et al., 2017
prox1a Fig. 1 with image from Wu et al., 2017
selenop2 Fig. 1 with image from Wu et al., 2017
wnt2bb Fig. 4 from Curado et al., 2010
Phenotype
Phenotype resulting from MO1-tomm22
Phenotype Fish Figures
cell population proliferation increased occurrence, abnormal gz15Tg + MO1-tomm22 Fig. 4 from Curado et al., 2010
cholangiocyte d2EGFP expression increased amount, abnormal kyu1Tg; s939Tg + MO1-tomm22 Fig. 5 with image from Wu et al., 2017
cholangiocyte Wnt signaling pathway increased occurrence, abnormal kyu1Tg; s939Tg + MO1-tomm22 Fig. 5 with image from Wu et al., 2017
hepatocyte decreased amount, abnormal gz15Tg + MO1-tomm22 Fig. 3 from Curado et al., 2010
hepatocyte ab-2f11 labeling increased amount, abnormal s939Tg + MO1-tomm22 Fig. 4 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal s939Tg + MO1-tomm22 Fig. 3 with image,  Fig. 4 with image from Wu et al., 2017
liver fabp10a expression decreased amount, abnormal WT + MO1-tomm22 Fig. 1 with image from Wu et al., 2017
liver EGFP expression decreased amount, abnormal as3Tg + MO1-tomm22 Fig. 1 with image from Wu et al., 2017
liver decreased size, abnormal gz15Tg + MO1-tomm22 Fig. 1 with image from Wu et al., 2017
Fig. 3,  Fig. 4 from Curado et al., 2010
liver d2EGFP expression increased amount, abnormal kyu1Tg; s939Tg + MO1-tomm22 Fig. 5 with image from Wu et al., 2017
liver cell death increased occurrence, abnormal WT + MO1-tomm22 Fig. 2 with image from Wu et al., 2017
liver Wnt signaling pathway increased occurrence, abnormal kyu1Tg; s939Tg + MO1-tomm22 Fig. 5 with image from Wu et al., 2017
Phenotype of all Fish created by or utilizing MO1-tomm22
Phenotype Fish Conditions Figures
liver fabp10a expression decreased amount, abnormal WT + MO1-tomm22 standard conditions Fig. 1 with image from Wu et al., 2017
liver cell death increased occurrence, abnormal WT + MO1-tomm22 standard conditions Fig. 2 with image from Wu et al., 2017
response to virus process quality, abnormal WT + MO1-tomm22 viral treatment: Chikungunya virus Fig. 7 with image from Palha et al., 2013
liver decreased size, abnormal WT + MO1-tomm22 standard conditions Fig. 1 with image from Wu et al., 2017
liver decreased size, abnormal as3Tg + MO1-tomm22 standard conditions Fig. 1 with image from Wu et al., 2017
liver EGFP expression decreased amount, abnormal as3Tg + MO1-tomm22 standard conditions Fig. 1 with image from Wu et al., 2017
liver decreased size, abnormal gz15Tg + MO1-tomm22 standard conditions Fig. 3,  Fig. 4 from Curado et al., 2010
hepatocyte decreased amount, abnormal gz15Tg + MO1-tomm22 standard conditions Fig. 3 from Curado et al., 2010
cell population proliferation increased occurrence, abnormal gz15Tg + MO1-tomm22 standard conditions Fig. 4 from Curado et al., 2010
hepatocyte ab-2f11 labeling increased amount, abnormal s939Tg + MO1-tomm22 standard conditions Fig. 4 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal s939Tg + MO1-tomm22 standard conditions Fig. 3 with image,  Fig. 4 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal s939Tg + MO1-tomm22 chemical treatment by environment: XAV939 Fig. 5 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal cz1701Tg; s959Tg + MO1-tomm22 chemical treatment: afimoxifene Fig. 4 with image from Wu et al., 2017
liver d2EGFP expression increased amount, abnormal kyu1Tg; s939Tg + MO1-tomm22 standard conditions Fig. 5 with image from Wu et al., 2017
liver Wnt signaling pathway increased occurrence, abnormal kyu1Tg; s939Tg + MO1-tomm22 standard conditions Fig. 5 with image from Wu et al., 2017
cholangiocyte d2EGFP expression increased amount, abnormal kyu1Tg; s939Tg + MO1-tomm22 standard conditions Fig. 5 with image from Wu et al., 2017
cholangiocyte Wnt signaling pathway increased occurrence, abnormal kyu1Tg; s939Tg + MO1-tomm22 standard conditions Fig. 5 with image from Wu et al., 2017
liver decreased size, abnormal wnt2bbs403/s403 + MO1-tomm22 standard conditions Fig. 4 from Curado et al., 2010
liver Wnt signaling pathway increased occurrence, abnormal c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 control Fig. 6 with image from Wu et al., 2017
liver d2EGFP expression amount, ameliorated c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 chemical treatment by environment: XAV939 Fig. 6 with image from Wu et al., 2017
liver Wnt signaling pathway occurrence, ameliorated c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 chemical ablation: macrophage, chemical treatment by environment: metronidazole Fig. 6 with image from Wu et al., 2017
liver d2EGFP expression amount, ameliorated c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 chemical ablation: macrophage, chemical treatment by environment: metronidazole Fig. 6 with image from Wu et al., 2017
liver d2EGFP expression increased amount, abnormal c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 control Fig. 6 with image from Wu et al., 2017
liver Wnt signaling pathway occurrence, ameliorated c264Tg; gl24Tg; kyu1Tg; s939Tg + MO1-tomm22 chemical treatment by environment: XAV939 Fig. 6 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal c264Tg; gl24Tg; s939Tg + MO1-tomm22 control Fig. 6 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal c264Tg; gl24Tg; s939Tg + MO1-tomm22 chemical ablation: macrophage, chemical treatment by environment: metronidazole Fig. 6 with image from Wu et al., 2017
cholangiocyte mCherry expression increased amount, abnormal cz1701Tg; s931Tg; s959Tg + MO1-tomm22 chemical treatment: afimoxifene Fig. 3 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal pt608Tg; s939Tg + MO1-tomm22 control Fig. 5 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal pt608Tg; s939Tg + MO1-tomm22 chemical treatment by environment: XAV939 Fig. 5 with image from Wu et al., 2017
hepatocyte cell population proliferation decreased occurrence, abnormal pt608Tg; s939Tg + MO1-tomm22 chemical treatment by environment: XAV939 Fig. 5 with image from Wu et al., 2017
liver cell death increased occurrence, abnormal s931Tg; s939Tg + MO1-tomm22 standard conditions Fig. 2 with image from Wu et al., 2017
liver macrophage increased amount, abnormal s931Tg; s939Tg; uwm12Tg + MO1-tomm22 standard conditions Fig. 6 with image from Wu et al., 2017
liver macrophage shape, abnormal s931Tg; s939Tg; uwm12Tg + MO1-tomm22 standard conditions Fig. 6 with image from Wu et al., 2017
liver macrophage increased amount, abnormal s931Tg; uwm12Tg + MO1-tomm22 standard conditions Fig. 6 with image from Wu et al., 2017
cholangiocyte mAGFP expression increased amount, abnormal c264Tg; gl24Tg; pt608Tg; s939Tg + MO1-tomm22 chemical ablation: macrophage, chemical treatment by environment: metronidazole Fig. 6 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal c264Tg; gl24Tg; pt608Tg; s939Tg + MO1-tomm22 control Fig. 6 with image from Wu et al., 2017
cholangiocyte mAGFP expression increased amount, abnormal c264Tg; gl24Tg; pt608Tg; s939Tg + MO1-tomm22 control Fig. 6 with image from Wu et al., 2017
hepatocyte mCherry expression increased amount, abnormal c264Tg; gl24Tg; pt608Tg; s939Tg + MO1-tomm22 chemical ablation: macrophage, chemical treatment by environment: metronidazole Fig. 6 with image from Wu et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.