Morpholino

MO1-ogt.1

ID
ZDB-MRPHLNO-090616-3
Name
MO1-ogt.1
Previous Names
  • OGT MO1 (1)
Target
Sequence
5' - CCACGTTCCCCACCGAGCTTGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ogt.1
Expressed Gene Anatomy Figures
egr2b Fig. 2 with image from Webster et al., 2009
emx3 Fig. 2 with image from Webster et al., 2009
gsc Fig. 4 with image from Webster et al., 2009
noto Fig. 2 with image from Webster et al., 2009
sebox Fig. 4 with image from Webster et al., 2009
sox17 Fig. 2 with image from Webster et al., 2009
tbxta Fig. 4 with image from Webster et al., 2009
tp53 Fig. 7 from DeRossi et al., 2017
tpma Fig. 2 with image from Webster et al., 2009
Phenotype
Phenotype resulting from MO1-ogt.1
Phenotype Fish Figures
endodermal cell decreased amount, abnormal WT + MO1-ogt.1 Fig. 2 with image from Webster et al., 2009
eye decreased size, abnormal WT + MO1-ogt.1 Fig. 2 with image from Webster et al., 2009
forebrain decreased size, abnormal WT + MO1-ogt.1 Fig. 2 with image from Webster et al., 2009
forerunner cell group decreased amount, abnormal WT + MO1-ogt.1 Fig. 2 with image from Webster et al., 2009
head decreased size, abnormal WT + MO1-ogt.1 Fig. 2 with image from Webster et al., 2009
hindbrain decreased size, abnormal WT + MO1-ogt.1 Fig. 2 with image from Webster et al., 2009
notochord kinked, abnormal WT + MO1-ogt.1 Fig. 2 with image from Webster et al., 2009
somite disorganized, abnormal WT + MO1-ogt.1 Fig. 2 with image from Webster et al., 2009
whole organism decreased length, abnormal WT + MO1-ogt.1 Fig. 2 with image from Webster et al., 2009
whole organism decreased size, abnormal WT + MO1-ogt.1 Fig. 2 with image from Webster et al., 2009
Phenotype of all Fish created by or utilizing MO1-ogt.1
Phenotype Fish Conditions Figures
hindbrain decreased size, abnormal WT + MO1-ogt.1 standard conditions Fig. 2 with image from Webster et al., 2009
forerunner cell group decreased amount, abnormal WT + MO1-ogt.1 standard conditions Fig. 2 with image from Webster et al., 2009
notochord kinked, abnormal WT + MO1-ogt.1 standard conditions Fig. 2 with image from Webster et al., 2009
head decreased size, abnormal WT + MO1-ogt.1 standard conditions Fig. 2 with image from Webster et al., 2009
endodermal cell decreased amount, abnormal WT + MO1-ogt.1 standard conditions Fig. 2 with image from Webster et al., 2009
forebrain decreased size, abnormal WT + MO1-ogt.1 standard conditions Fig. 2 with image from Webster et al., 2009
eye decreased size, abnormal WT + MO1-ogt.1 standard conditions Fig. 2 with image from Webster et al., 2009
somite disorganized, abnormal WT + MO1-ogt.1 standard conditions Fig. 2 with image from Webster et al., 2009
whole organism decreased length, abnormal WT + MO1-ogt.1 standard conditions Fig. 2 with image from Webster et al., 2009
whole organism decreased size, abnormal WT + MO1-ogt.1 standard conditions Fig. 2 with image from Webster et al., 2009
whole organism Ab1-O-GlcNAc labeling amount, ameliorated AB + MO1-mpi + MO1-ogt.1 standard conditions Fig. 7 from DeRossi et al., 2017
whole organism Ab2-ogt labeling amount, ameliorated AB + MO1-mpi + MO1-ogt.1 control Fig. 7 from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-mpi + MO1-ogt.1 standard conditions Fig. 7 from DeRossi et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.